Direkt zum Inhalt
Merck

EHU132901

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGGGTGGGGCTTTTTGTAGAAACTGTGGATTCTTTTTCTCTCGTGGTCTCACTTTGTTACTTGTTTCTGTCCCCGGGAGCCTCAGGGCTCTGAGAGCTGTGCTCCAGGCCAGGGGTTACACCTGCCCTCCGTGGTCCCTCCCTGGGCTCCAGGGGCCTCTGGTGCGGTTCCGGGAAGAAGCCACACCCCAGAGGTGACAGGTGAGCCCCTGCCACACCCCAGCCTCTGACTTGCTGTGTTGTCCAGAGGTGAGGCTGGGCCCTCCCTGGTCTCCAGCTTAAACAGGAGTGAACTCCCTCTGTCCCCAGGGCCTCCCTTCTGGGCCCCCTACAGCCCACCCTACCCCTCCTCCATGGGCCCTGCAGGAGGGGAGACCCACCTTGAAGTGGGGGATCAGTAGAGGCTTGCACTGCCTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ning Qu et al.
International journal of oncology, 50(5), 1683-1692 (2017-04-11)
Sirtuin 6 (SIRT6) is a member of the SIRT family NAD+‑dependent deacetylases reported to function in controlling organism homeostasis, lifespan, and diseases. This study investigated the role of SIRT6 in papillary thyroid cancer (PTC). Data of 391 PTC patients was extracted
Ming-Yue Cheng et al.
American journal of translational research, 8(11), 5005-5015 (2016-12-03)
The present study explored changes of the SIRT6/NF-κB pathway in myocardial hypoxia/reoxygenation induced injury and the effects on mitochondrial damage and myocardial damage by regulating SIRT6. SIRT6 expression decreased and NF-κB expression increased in H9c2 cells during hypoxic injury. Cell
Ganye Zhao et al.
Aging, 8(10), 2308-2323 (2016-10-31)
Sirtuin6(SIRT6) has been implicated as a key factor in aging and aging-related diseases. However, the role of SIRT6 in cellular senescence has not been fully understood. Here, we show that SIRT6 repressed the expression of p27Kip1 (p27) in cellular senescence.
Benjamin A Harlan et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7084-7091 (2019-03-08)
Sirtuins (SIRTs) are NAD+-dependent deacylases that play a key role in transcription, DNA repair, metabolism, and oxidative stress resistance. Increasing NAD+ availability regulates endogenous SIRT activity, leading to increased resistance to oxidative stress and decreased mitochondrial reactive oxygen production in
Yujuan Yang et al.
European journal of pharmacology, 859, 172516-172516 (2019-07-03)
Angiotensin II (Ang II) is a vasoactive peptide that elevates arterial blood pressure and leads to hypertension. Ang II has been reported to induce endothelial dysfunction by induction of apoptosis and oxidative stress in vascular endothelial cells. Sirtuin6 (SIRT6) has

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.