Direkt zum Inhalt
Merck

EHU120781

Sigma-Aldrich

MISSION® esiRNA

targeting human CNR2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTGGGTGACAGAGATAGCCAATGGCTCCAAGGATGGCTTGGATTCCAACCCTATGAAGGATTACATGATCCTGAGTGGTCCCCAGAAGACAGCTGTTGCTGTGTTGTGCACTCTTCTGGGCCTGCTAAGTGCCCTGGAGAACGTGGCTGTGCTCTATCTGATCCTGTCCTCCCACCAACTCCGCCGGAAGCCCTCATACCTGTTCATTGGCAGCTTGGCTGGGGCTGACTTCCTGGCCAGTGTGGTCTTTGCATGCAGCTTTGTGAATTTCCATGTTTTCCATGGTGTGGATTCCAAGGCTGTCTTCCTGCTGAAGATTGGCAGCGTGACTATGACCTTCACAGCCTCTGTGGGTAGCCTCCTGCTGACCGCCATTGACCGATACCTCTGCCTGCGCTATCCACCTTCCTACAAAGCTCTGCTCACCCGTGGAAGGGCACTGGTGACCCTGGGCATCATGTGGGTCCTCTCAGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Young Sun Hwang et al.
Chemico-biological interactions, 273, 107-114 (2017-06-12)
Melanogenesis plays a critical role in the protection of skin against external stresses such as ultraviolet irradiation and oxidative stressors. This study was aimed to investigate the effects of cannabidiol on melanogenesis and its mechanisms of action in human epidermal
Sabrina Fechtner et al.
Clinical and experimental rheumatology, 37(6), 1026-1035 (2019-04-04)
Recent studies showed that the expression of cannabinoid receptor 2 (CB2), not CB1, is upregulated at both the mRNA and protein levels in rheumatoid arthritis synovial fibroblasts (RASFs), however, little is known about its endogenous role in pro-inflammatory cytokine signalling
Sabrina Fechtner et al.
Frontiers in immunology, 10, 1027-1027 (2019-05-30)
Management of pain in the treatment of rheumatoid arthritis (RA) is a priority that is not fully addressed by the conventional therapies. In the present study, we evaluated the efficacy of cannabinoid receptor 2 (CB2) agonist JWH-015 using RA synovial
Lei Tian et al.
Frontiers in immunology, 8, 1214-1214 (2017-10-17)
Macrophage M1/M2 polarization mediates tissue damage and inflammatory responses. Cannabinoid receptor (CB) 1 participated in liver fibrogenesis by affecting bone marrow (BM)-derived monocytes/macrophages (BMMs) activation. However, the knowledge of whether CB1 is involved in the polarization of BMMs remains limited.
Ryosuke Kamikubo et al.
Molecular nutrition & food research, 60(10), 2228-2242 (2016-05-29)
Nonalcoholic fatty liver disease is currently the most common chronic liver disease worldwide, characterized by excessive hepatic lipid accumulation without significant ethanol consumption. We have performed a screening for medicinal foods that inhibit hepatocytic lipid accumulation through activation of AMP-activated

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.