Direkt zum Inhalt
Merck

EHU111621

Sigma-Aldrich

MISSION® esiRNA

targeting human TPT1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAACAAATGTGGCAATTATTTTGGATCTATCACCTGTCATCATAACTGGCTTCTGCTTGTCATCCACA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jian-Hui Shen et al.
Biotechnology and applied biochemistry, 63(1), 5-14 (2014-12-20)
Osteosarcoma (OS) remains the most frequent primary malignant bone tumor in adolescents. However, the molecular cause of the disease is poorly elucidated. In the present study, we primarily found that translationally controlled tumor protein (TCTP) was overexpressed in human OS
Mari Kaarbø et al.
PloS one, 8(7), e69398-e69398 (2013-07-31)
TCTP has been implicated in a plethora of important cellular processes related to cell growth, cell cycle progression, malignant transformation and inhibition of apoptosis. In addition to these intracellular functions, TCTP has extracellular functions and plays an important role in
Seong-Yeon Bae et al.
Scientific reports, 5, 8061-8061 (2015-01-28)
Translationally controlled tumor protein (TCTP), is a highly conserved protein involved in fundamental processes, such as cell proliferation and growth, tumorigenesis, apoptosis, pluripotency, and cell cycle regulation. TCTP also inhibits Na,K-ATPase whose subunits have been suggested as a marker of
Ruilin Sun et al.
OncoTargets and therapy, 12, 1641-1653 (2019-03-19)
Lung cancer is the most common and lethal malignancy worldwide. TCTP is highly expressed in various cancers including lung cancer. Epithelial-mesenchymal transition (EMT) could increase cancer cell invasion. Whether TCTP's expression is associated with EMT in lung adenocarcinoma is largely
Yu You et al.
Journal of Cancer, 8(14), 2854-2865 (2017-09-21)
MicroRNAs (miRNAs) are increasingly recognized as being involved in pancreatic cancer progression by directly regulating the expression of their targets. In this study, we showed that miR-216b-5p expression was significantly decreased in pancreatic cancer tissues and cell lines. In addition

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.