Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU108041

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT7

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAGTGTGGACACTGCTTCAGAAAGGGAGAAGCGTTAGTGCTGCCGACCTGAGCGAGGCCGAGCCACTCACCCACATGAGCATCACCCGTCTGCATGAGCAGAAGCTGGTGCAGCATGTGGTGTCTCAGAACTGTGACGGGCTCCACCTGAGGAGTGGGCTGCCGCGCACGGCCATCTCCGAGCTCCACGGGAACATGTACATTGAAGTCTGTACCTCCTGCGTTCCCAACAGGGAGTACGTGCGGGTGTTCGATGTGACGGAGCGCACTGCCCTCCACAGACACCAGACAGGCCGGACCTGCCACAAGTGTGGGACCCAGCTGCGGGACACCATTGTGCACTTTGGGGAGAGGGGGACGTTGGGGCAGCCTTTGAACTGGGAAGCGACCGAGGCTGCCAGCAGAGCAGACACCATCCT

Ensembl | Human Hinterlegungsnummer

ENSG00000187531

NCBI-Hinterlegungsnummer

NM_016538

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SIRT7(51547) , SIRT7(51547)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Romain Haider et al.
Oncotarget, 8(44), 77309-77316 (2017-11-05)
Predictive biomarkers for advanced prostate cancer (PCa) are still missing. The sirtuin 7 (SIRT7) has been linked to tumorogenesis but its role in prostate cancer is poorly documented. To determine if SIRT7 can be a biomarker for aggressive prostate cancer
Bin Jia et al.
IUBMB life, 73(1), 264-272 (2020-12-17)
Oral squamous cell carcinoma (OSCC) is a common malignant cancer with unfavorable prognosis, and the epithelial-to-mesenchymal transition (EMT) is a critical contributor to OSCC metastasis. Recently, we have shown that sirtuin 7 (Sirt7) is associated with EMT and OSCC metastasis
Anne E Wyman et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L945-L958 (2017-04-08)
Pulmonary fibrosis is a severe condition with no cure and limited therapeutic options. A better understanding of its pathophysiology is needed. Recent studies have suggested that pulmonary fibrosis may be driven by accelerated aging-related mechanisms. Sirtuins (SIRTs), particularly SIRT1, SIRT3
Wang Wei et al.
American journal of cancer research, 7(9), 1788-1803 (2017-10-06)
It is still a controversy whether the role of Sirtuin 7 (SIRT7) is an oncogene or a tumor suppressor gene in cancer as SIRT7 may have different functions in different types of cancer. Particularly, the specific roles of SIRT7 in
Wenzhi Li et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 100, 257-266 (2018-02-14)
Accumulating evidence indicates that sirtuin7 (SIRT7) plays an oncogenic role in the main types of liver cancer, hepatocellular carcinoma (HCC). Nevertheless, the clinical significance of SIRT7 and its role in cholangiocarcinoma (CCA) is largely undiscovered. Here, we found that SIRT7
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.