Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU100711

Sigma-Aldrich

MISSION® esiRNA

targeting human TGM2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGAGCATGAACATGGGCAGTGACTTTGACGTCTTTGCCCACATCACCAACAACACCGCTGAGGAGTACGTCTGCCGCCTCCTGCTCTGTGCCCGCACCGTCAGCTACAATGGGATCTTGGGGCCCGAGTGTGGCACCAAGTACCTGCTCAACCTCAACCTGGAGCCTTTCTCTGAGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTGCCTTACGG

Ensembl | Human Hinterlegungsnummer

ENSG00000198959

NCBI-Hinterlegungsnummer

NM_004613

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TGM2(7052) , TGM2(7052)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Robin Delaine-Smith et al.
Cancers, 11(5) (2019-05-24)
Colorectal cancer is the third most common cancer worldwide, and the fourth leading cause of malignancy-related mortality. This highlights the need to understand the processes driving this disease in order to develop new treatments and improve patient outcomes. A potential
Yesim Bagatur et al.
Cell adhesion & migration, 12(2), 138-151 (2017-05-13)
Tissue transglutaminase (TG2) is the ubiquitously expressed member of transglutaminase family and shown to play a critical role in the development and progression of drug resistance malignancies. We have previously showed the association of TG2 upregulation with progression and metastasis
Ramon L Serrano et al.
PloS one, 14(4), e0212235-e0212235 (2019-04-04)
Neointimal hyperplasia, stimulated by injury and certain vascular diseases, promotes artery obstruction and tissue ischemia. In vascular smooth muscle cell (VSMCs), multiple modulators of protein handling machinery regulate intimal hyperplasia. These include elements of the VSMC unfolded protein response to
Deborah T Leicht et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 9(6), 872-881 (2014-05-16)
Esophageal adenocarcinomas (EAC) are aggressive cancers that are increasing in incidence and associated with a poor prognosis. The identification of highly expressed genes in EAC relative to metaplastic Barrett's esophagus (BE) may provide new targets for novel early cancer detection
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.