Direkt zum Inhalt
Merck

EHU093591

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAAACTGGGAAGCTTGATGGACCAGACAAATAGGATGATGGCTGCCCCCACACAATAAATGGTAACATAGGAGACATCCACATCCCAATTCTGACAAGACCTCATGCCTGAAGACAGCTTGGGCAGGTGAAACCAGAATATGTGAACTGAGTGGACACCCGAGGCTGCCACTGGAATGTCTTCTCAGGCCATGAGCTGCAGTGACTGGTAGGGCTGTGTTTACAGTCAGGGCCACCCCGTCACATATACAAAGGAGCTGCCTGCCTGTTTGCTGTGTTGAACTCTTCACTCTGCTGAAGCTCCTAATGGAAAAAGCTTTCTTCTGACTGTGACCCTCTTGAACTGAATCAGACCAACTGGAATCCCAGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Anwendung

MISSION® esiRNA has been used for transfection of cells to target SIRT3.

Biochem./physiol. Wirkung

SIRT3 (sirtuin 3) is a mitochondrial deacetylase, which acts as an oncogene. It is associated with the initiation and progression of certain cancers. However, in some cases it also works anti-oncogenically. It plays a major role in mitochondrial activity via deacetylating proteins associated with energy metabolism, ATP generation, redox optimization, and mitochondrial biogenesis. It is also involved in transcription, insulin secretion and apoptosis. Deacetylation of cyclophilin-D via SIRT3 inhibits age-associated cardiac hypertrophy. SIRT3 also exhibits neuroprotective roles.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mitochondrial SIRT3 mediates adaptive responses of neurons to exercise and metabolic and excitatory challenges.
Cheng A
Cell Metabolism, 23, 128-142 (2016)
Xiaokan Zhang et al.
Circulation, 137(19), 2052-2067 (2018-01-14)
Heart failure leads to mitochondrial dysfunction and metabolic abnormalities of the failing myocardium coupled with an energy-depleted state and cardiac remodeling. The mitochondrial deacetylase sirtuin 3 (SIRT3) plays a pivotal role in the maintenance of mitochondrial function through regulating the
Chao Song et al.
Free radical biology & medicine, 112, 616-630 (2017-09-16)
Mitochondrial reactive oxygen species (ROS) production has been implicated in the pathogenesis of fluoride toxicity in liver. Melatonin, an indolamine synthesized in the pineal gland, was previously shown to protect against sodium fluoride (NaF)-induced hepatotoxicity. This study investigated the protective
Cai Shumin et al.
Cell death discovery, 4, 52-52 (2018-05-16)
Genipin (GP) is commonly used to treat cardiovascular diseases; however, the protective action of GP against vascular hyperpermeability (VH) has not been reported. We previously reported that intrinsic apoptotic signaling (IAS) is involved in VH following hemorrhagic shock (HS). GP
Pro-Proliferative Function of Mitochondrial Sirtuin Deacetylase SIRT3 in Human Melanoma.
George J
The Journal of Investigative Dermatology, 136, 809-809 (2016)

Global Trade Item Number

SKUGTIN
EHU093591-20UG4061831356236
EHU093591-50UG4061828363216

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.