Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU088741

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC8

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCCAGTATGGTGCATTCTTTGATTGAAGCATATGCACTGCATAAGCAGATGAGGATAGTTAAGCCTAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCTTATCTGCAGCATCTCCAGAAGGTCAGCCAAGAGGGCGATGATGATCATCCGGACTCCATAGAATATGGGCTAGGTTATGACTGCCCAGCCACTGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGGGCTACGATCACAGCTGCCCAATGCCTGATTGACGGAATGTGCAAAGTAGCAATTAACTGGTCTGGAGGGTGGCATCATGCAAAGAAAGATGAAGCATCTGGTTTTTGTTATCTCAATGATGCTGTCCTGGGAATATTACGATTGCGACGGAAATTTGAGCGTATTCTCTACGTGGATTTGGATCTGCA

Ensembl | Human Hinterlegungsnummer

ENSG00000147099

NCBI-Hinterlegungsnummer

NM_018486

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... HDAC8(55869) , HDAC8(55869)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Michael F Emmons et al.
Cancer research, 79(11), 2947-2961 (2019-04-17)
Melanoma cells have the ability to switch to a dedifferentiated, invasive phenotype in response to multiple stimuli. Here, we show that exposure of melanomas to multiple stresses including BRAF-MEK inhibitor therapy, hypoxia, and UV irradiation leads to an increase in
G R Vanaja et al.
Cell communication and signaling : CCS, 16(1), 20-20 (2018-05-03)
Histone deacetylases (HDACs) are involved in epigenetic gene regulation via deacetylation of acetylated lysine residues of both histone and non-histone proteins. Among the 18 HDACs identified in humans, HDAC8, a class I HDAC, is best understood structurally and enzymatically. However
Zhouxiang Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1645-1653 (2016-11-17)
Despite the use of novel anti-myeloma agents,nearly all patients will eventually relapse or become refractory to drug treatment. New and more effective drugs for multiple myeloma (MM) are urgently needed. The JAK-STAT signaling pathway is important in the proliferation of
Ganggang Kong et al.
Journal of neurotrauma, 34(18), 2645-2655 (2017-07-08)
The ketone metabolite β-hydroxybutyrate (βOHB), is reported to be neuroprotective after spinal cord injury (SCI) in rats, but the underlying mechanism remains unknown. The present study aims to investigate effects of βOHB on suppression of oxidative stress and inhibition of
Jia Li et al.
American journal of physiology. Cell physiology, 307(3), C288-C295 (2014-06-13)
Histone deacetylases (HDACs) are a family of enzymes that mediate nucleosomal histone deacetylation and gene expression. Some members of the HDAC family have also been implicated in nonhistone protein deacetylation, which modulates cell-cycle control, differentiation, and cell migration. However, the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.