Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU088121

Sigma-Aldrich

MISSION® esiRNA

targeting human PTBP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTG

Ensembl | Human Hinterlegungsnummer

ENSG00000011304

NCBI-Hinterlegungsnummer

NM_031991

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PTBP1(5725) , PTBP1(5725)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Chun-Yu Cho et al.
Scientific reports, 9(1), 16922-16922 (2019-11-16)
AXL is expressed in many types of cancer and promotes cancer cell survival, metastasis and drug resistance. Here, we focus on identifying modulators that regulate AXL at the mRNA level. We have previously observed that the AXL promoter activity is
Xin Fu et al.
Biochimica et biophysica acta. Molecular cell research, 1865(11 Pt A), 1552-1565 (2018-10-18)
Mesenchymal stem cells (MSCs) hold great promise as attractive vehicles to deliver therapeutic agents against cancer, while the cross-talk between MSCs and cancer cells remains controversial. Here in an indirect co-culture system we observed that MSCs induced the malignancy transformation
Kohei Taniguchi et al.
International journal of molecular sciences, 19(5) (2018-04-27)
Pyruvate kinase is known as the glycolytic enzyme catalyzing the final step in glycolysis. In mammals, two different forms of it exist, i.e., pyruvate kinase M1/2 (PKM) and pyruvate kinase L/R (PKLR). Also, PKM has two isoforms, i.e., PKM1 and
Aline Marnef et al.
Nucleic acids research, 44(3), 1342-1353 (2015-12-15)
Human polypyrimidine tract-binding protein PTB is a multifunctional RNA-binding protein with four RNA recognition motifs (RRM1 to RRM4). PTB is a nucleocytoplasmic shuttle protein that functions as a key regulator of alternative pre-mRNA splicing in the nucleoplasm and promotes internal
Mohamed Sham Shihabudeen Haider Ali et al.
Nucleic acids research, 47(3), 1505-1522 (2018-11-27)
The role of long non-coding RNAs (lncRNAs) in regulating endothelial function through the DNA damage response (DDR) remains poorly understood. In this study, we demonstrate that lncRNA maternally expressed gene 3 (Meg3) interacts with the RNA binding protein polypyrimidine tract
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.