Direkt zum Inhalt
Merck

EHU086801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF10

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGGGAACACCTGATTTTCATACAATCCCAGCATTTTGTTTGACTCCACCTTACAGTCCTTCTGACTTTGAACCCTCTCAAGTGTCAAATCTGATGGCACCAGCGCCATCTACTGTACACTTCAAGTCACTCTCAGATACTGCCAAACCTCACATTGCCGCACCTTTCAAAGAGGAAGAAAAGAGCCCAGTATCTGCCCCCAAACTCCCCAAAGCTCAGGCAACAAGTGTGATTCGTCATACAGCTGATGCCCAGCTATGTAACCACCAGACCTGCCCAATGAAAGCAGCCAGCATCCTCAACTATCAGAACAATTCTTTTAGAAGAAGAACCCACCTAAATGTTGAGGCTGCAAGAAAGAACATACCATGTGCCGCTGTGTCACCAAACAGATCCAAATGTGAGAGAAACACAGTGGCAGATGTTGATGAGA

Ensembl | Human Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Abigail A Delaney et al.
Biology of reproduction, 95(3), 62-62 (2016-08-05)
Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human
Vivek Kumar Mishra et al.
Cancer research, 77(9), 2387-2400 (2017-03-03)
TGFβ-SMAD signaling exerts a contextual effect that suppresses malignant growth early in epithelial tumorigenesis but promotes metastasis at later stages. Longstanding challenges in resolving this functional dichotomy may uncover new strategies to treat advanced carcinomas. The Krüppel-like transcription factor, KLF10
Malayannan Subramaniam et al.
Journal of cellular physiology, 233(4), 3540-3551 (2017-10-19)
TIEG knockout (KO) mice exhibit a female-specific osteopenic phenotype and altered expression of TIEG in humans is associated with osteoporosis. Gene expression profiling studies identified sclerostin as one of the most highly up-regulated transcripts in the long bones of TIEG
Jong Min Lee et al.
Molecular therapy. Nucleic acids, 17, 310-322 (2019-07-10)
We investigated the functional role of miR-892b as a novel inhibitor of chondrocyte hypertrophy during TGF-β-mediated chondrogenesis of human mesenchymal stem cells (hMSCs). The expression of miR-892b during TGF-β-mediated chondrogenesis of hMSCs and the effects of miR-892b overexpression on chondrogenic
Chun-Liang Lin et al.
EMBO molecular medicine, 11(5) (2019-04-06)
Diabetic nephropathy is the leading cause of end-stage renal disease. Although dysfunction of podocytes, also termed glomerular visceral epithelial cells, is critically associated with diabetic nephropathy, the mechanism underlying podocyte dysfunction still remains obscure. Here, we identify that KDM6A, a

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.