Direkt zum Inhalt
Merck

EHU077321

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAATCCCACACATCTTGCTGACTTCACTCAAGTGCAAACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATAGCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATGGCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATCAGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAAAAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATTATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAAAGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Irina M Shapiro et al.
Science translational medicine, 6(237), 237ra68-237ra68 (2014-05-23)
The goal of targeted therapy is to match a selective drug with a genetic lesion that predicts for drug sensitivity. In a diverse panel of cancer cell lines, we found that the cells most sensitive to focal adhesion kinase (FAK)
Juan Pablo Macagno et al.
PLoS genetics, 10(3), e1004262-e1004262 (2014-03-29)
Receptor Tyrosine Kinases (RTKs) and Focal Adhesion Kinase (FAK) regulate multiple signalling pathways, including mitogen-activated protein (MAP) kinase pathway. FAK interacts with several RTKs but little is known about how FAK regulates their downstream signalling. Here we investigated how FAK
Qi Cao et al.
Oncotarget, 7(47), 77468-77481 (2016-10-21)
To investigate the effects of microRNA-7 (miR-7) on the proliferation, migration and invasion of non-small cell lung cancer NSCLC) cells by targeting FAK through ERK/MAPK signaling pathway. NSCLC tissues and adjacent normal tissues were obtained from 160 NSCLC patients after
Frank Aboubakar Nana et al.
Molecular cancer therapeutics, 18(1), 17-27 (2018-10-26)
Small cell lung cancer (SCLC) has a poor prognosis. Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase regulating cell proliferation, survival, migration, and invasion, which is overexpressed and/or activated in several cancers, including SCLC. We wanted to determine whether
Zhaokang Cheng et al.
The Journal of biological chemistry, 292(6), 2065-2079 (2016-12-21)
Autophagy is an evolutionarily conserved intracellular degradation/recycling system that is essential for cellular homeostasis but is dysregulated in a number of diseases, including myocardial hypertrophy. Although it is clear that limiting or accelerating autophagic flux can result in pathological cardiac

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.