Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU075051

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGGACCTGATGCAGAACATCATGAATGACATGCCGATCTACATGTACTCCGTGTGCAACGTGATGTCTGGCGACCAGGACAACTGGCTCCGCACCAACTGGGTGTACCGAGGAGAGGCTGAGCGTATCTTCATTGAGCTCAAGTTTACTGTACGTGACTGCAACAGCTTCCCTGGTGGCGCCAGCTCCTGCAAGGAGACTTTCAACCTCTACTATGCCGAGTCGGACCTGGACTACGGCACCAACTTCCAGAAGCGCCTGTTCACCAAGATTGACACCATTGCGCCCGATGAGATCACCGTCAGCAGCGACTTCGAGGCACGCCACGTGAAGCTGAACGTGGAGGAGCGCTCCGTGGGGCCGCTCACCCGCAAAGGCTTCTACCTGGCCTTCCAGGATATCGGTGCCT

Ensembl | Human Hinterlegungsnummer

ENSG00000142627

NCBI-Hinterlegungsnummer

NM_004431

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... EPHA2(1969) , EPHA2(1969)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hee Sung Kim et al.
Scientific reports, 9(1), 3414-3414 (2019-03-06)
Genetically deregulated tumor cells generate vascular channels by vasculogenic mimicry (VM) that is independent of endothelial blood vessels. The morphological characteristics of VM and the role of EphA2 in the formation of VM were evaluated in 144 clinical samples of
Qiaoli Wu et al.
Biochemical and biophysical research communications, 503(4), 2436-2442 (2018-07-04)
MiR-124-3p and EphA2 are aberrantly expressed in glioma tissue specimens. In the present study, we firstly investigated that miR-124-3p inhibits EphA2 expression mediated by binding its 3'-UTR to regulate the progression of human glioma. The U87MG and LN229 cells were transfected
Xin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(4), 5495-5509 (2019-01-23)
The balance of myogenic and adipogenic differentiation is crucial for skeletal muscle homeostasis. Given the vital role of membrane proteins (MBPs) in cell signal perception, membrane proteomics was conducted to delineate mechanisms regulating differentiation of adipogenic and myogenic precursors in
Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Marc Swidergall et al.
PLoS pathogens, 17(1), e1009221-e1009221 (2021-01-21)
During oropharyngeal candidiasis (OPC), Candida albicans invades and damages oral epithelial cells, which respond by producing proinflammatory mediators that recruit phagocytes to foci of infection. The ephrin type-A receptor 2 (EphA2) detects β-glucan and plays a central role in stimulating
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.