Direkt zum Inhalt
Merck

EHU073901

Sigma-Aldrich

MISSION® esiRNA

targeting human AXIN1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTTCTGGTTTGCCTGCACTGGCTTCAGGAAGCTGGAGCCCTGTGACTCGAACGAGGAGAAGAGGCTGAAGCTGGCGAGAGCCATCTACCGAAAGTACATTCTTGATAACAATGGCATCGTGTCCCGGCAGACCAAGCCAGCCACCAAGAGCTTCATAAAGGGCTGCATCATGAAGCAGCTGATCGATCCTGCCATGTTTGACCAGGCCCAGACCGAAATCCAGGCCACTATGGAGGAAAACACCTATCCCTCCTTCCTTAAGTCTGATATTTATTTGGAATATACGAGGACAGGCTCGGAGAGCCCCAAAGTCTGTAGTGACCAGAGCTCTGGGTCAGGGACAGGGAAGGGCATATCTGGATACCTGCCGACCTTAAATGAAGATGAGGAATGGAAGTGTGACCAGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yu Chen et al.
PloS one, 10(7), e0133115-e0133115 (2015-07-24)
During development, scaffold proteins serve as important platforms for orchestrating signaling complexes to transduce extracellular stimuli into intracellular responses that regulate dendritic spine morphology and function. Axin ("axis inhibitor") is a key scaffold protein in canonical Wnt signaling that interacts
Yongjuan Zhang et al.
Biochemical and biophysical research communications, 513(1), 261-268 (2019-04-08)
Caveolin-1 has been reported to play an important role in the pathogenesis of acute respiratory distress syndrome (ARDS). This study was designed to identify Caveolin-1-interacting proteins to reveal the molecular mechanisms of ARDS. Yeast two-hybrid screening was performed using Caveolin-1
Shiwei Zhou et al.
Pharmaceutics, 13(3) (2021-04-04)
Genetic evidence has indicated that β-catenin plays a vital role in glucose and lipid metabolism. Here, we investigated whether pyrvinium, an anthelmintic agent previously reported as a down-regulator of cellular β-catenin levels, conferred any metabolic advantages in treatment of metabolic
Dongshao Chen et al.
Cancer management and research, 11, 1349-1362 (2019-02-28)
Characterized by elevated AFP levels in serum, AFP-producing gastric cancer (APGC) is a very special type of gastric cancer (GC) that is difficult to treat and has poor prognosis. However, little is known about the role of AFP in GC
Hae-Kyung Lee et al.
Oncogene, 37(31), 4273-4286 (2018-05-02)
The adenomatous polyposis coli (APC) protein has a tumor-suppressor function by acting as a negative regulator of the Wnt signaling pathway. While its role as a tumor suppressor is well-defined, the post-translational modifications that regulate APC stability are not fully

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.