Direkt zum Inhalt
Merck

EHU072181

Sigma-Aldrich

MISSION® esiRNA

targeting human PITX2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTCAAAGGGATGTCCTCAGTGTCTGACATCTTTCACTACAAGTATTTCTAACAGTTGCAAGGACACATACACAAACAAATGTTTGACTGGATATGACATTTTAACATTACTATAAGCTTGTTATTTTTTAAGTTTAGCATTGTTAACATTTAAATGACTGAAAGGATGTATATATATCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAGGTTAGGCTTTAAAATAAAGCATGTTATACAGAAGCGATTAGGATTTTTCGCTTGCGAGCAAGGGAGTGTATATACTAAATGCCACACTGTATGTTTCTAACATATTATTATTATTATAAAAAATGTGTGAATATCAGTTTTAGAATAGTTTCTCTGGTGGATGCAATGATG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wing-Kee Lee et al.
Cancer letters, 449, 237-251 (2019-02-12)
Oncogenic pituitary homeobox 2 (PITX2), a de facto master regulator of developmental organ asymmetry, previously upregulated multidrug resistance (MDR) P-glycoprotein ABCB1 in A498 renal cell carcinoma (RCC) cells. The role of PITX2 isoforms in MDR cancers was investigated. Data mining
Yu-Hsun Kao et al.
European journal of clinical investigation, 49(10), e13160-e13160 (2019-08-06)
A Pitx2c deficiency increases the risk of atrial fibrillation (AF). Atrial structural remodelling with fibrosis blocks electrical conduction and leads to arrhythmogenesis. A Pitx2c deficiency enhances profibrotic transforming growth factor (TGF)-β expression and calcium dysregulation, suggesting that Pitx2c may play
Estefanía Lozano-Velasco et al.
Cardiovascular research, 109(1), 55-66 (2015-08-06)
Atrial fibrillation (AF) is the most common type of arrhythmia in humans, yet the genetic cause of AF remains elusive. Genome-wide association studies (GWASs) have reported risk variants in four distinct genetic loci, and more recently, a meta-GWAS has further
Estefanía Lozano-Velasco et al.
Molecular and cellular biology, 35(17), 2892-2909 (2015-06-10)
The acquisition of a proliferating-cell status from a quiescent state as well as the shift between proliferation and differentiation are key developmental steps in skeletal-muscle stem cells (satellite cells) to provide proper muscle regeneration. However, how satellite cell proliferation is
Ryuta Tanimoto et al.
Endocrinology, 156(1), 58-70 (2014-11-05)
The growth factor progranulin is as an important regulator of transformation in several cellular systems. We have previously demonstrated that progranulin acts as an autocrine growth factor and stimulates motility, proliferation, and anchorage-independent growth of castration-resistant prostate cancer cells, supporting

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.