Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU071121

Sigma-Aldrich

MISSION® esiRNA

targeting human NLRP3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCTGGAGGATGTGGACTTGAAGAAATTTAAGATGCACTTAGAGGACTATCCTCCCCAGAAGGGCTGCATCCCCCTCCCGAGGGGTCAGACAGAGAAGGCAGACCATGTGGATCTAGCCACGCTAATGATCGACTTCAATGGGGAGGAGAAGGCGTGGGCCATGGCCGTGTGGATCTTCGCTGCGATCAACAGGAGAGACCTTTATGAGAAAGCAAAAAGAGATGAGCCGAAGTGGGGTTCAGATAATGCACGTGTTTCGAATCCCACTGTGATATGCCAGGAAGACAGCATTGAAGAGGAGTGGATGGGTTTACTGGAGTACCTTTCGAGAATCTCTATTTGTAAAATGAAGAAAGATTACCGTAAGAAGTACAGAAAGTACGTGAGAAGCAGATTCCAGTGCATTGAA

Ensembl | Human Hinterlegungsnummer

ENSG00000162711

NCBI-Hinterlegungsnummer

NM_183395

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... NLRP3(114548) , NLRP3(114548)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

S F Khaiboullina et al.
Scientific reports, 7(1), 16050-16050 (2017-11-24)
ZIKV causes microcephaly by crossing the placental barrier, however, the mechanism of trans-placental dissemination of ZIKV remains unknown. Here, we sought to determine whether monocytes, which can cross tissue barriers, assist ZIKV dissemination to the fetus. We determined this by infecting monocytes
Maureen C Ty et al.
EMBO molecular medicine, 11(8), e9903-e9903 (2019-07-03)
Malaria is a highly inflammatory disease caused by Plasmodium infection of host erythrocytes. However, the parasite does not induce inflammatory cytokine responses in macrophages in vitro and the source of inflammation in patients remains unclear. Here, we identify oxidative stress, which
Sheng-Tao Yao et al.
Journal of molecular neuroscience : MN, 61(3), 385-395 (2016-12-10)
Complement-mediated inflammation plays a vital role in intracerebral hemorrhage (ICH), implicating pro-inflammatory factor interleukin-1beta (IL-1β) secretion. Brain samples and contralateral hemiencephalon were all collected and detected by Western blot. NLRP3 expression was located by dual immunofluorescence staining at 1, 3
Zhe Lin et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2890-2900 (2018-06-03)
Oxidative stress and inflammation are closely related to cardiovascular diseases. Although hydrogen sulfide (H2S) has been shown to have powerful anti-oxidative and anti-inflammatory properties, its role in macrophage inflammation was poorly understood. The aim of this study was to investigate
Qin Hu et al.
BioFactors (Oxford, England), 44(2), 123-136 (2017-12-02)
Increasing evidence demonstrates that pyroptosis, pro-inflammatory programmed cell death, is linked to atherosclerosis; however, the underlying mechanisms remain to be elucidated. Dihydromyricetin (DHM), a natural flavonoid, was reported to exert anti-oxidative and anti-inflammatory bioactivities. However, the effect of DHM on
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.