Direkt zum Inhalt
Merck

EHU068241

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATACACGGGACGTTGAGCACAACGTATCTCCTGGCTACAATTTCAGGTTTGCCAAGTACTACAGAGACCTGGCTGGCAACGAGCAGCGCACGCTCATCAAGGCCTATGGCATCCGCTTCGACATCATTGTGTTTGGGAAGGCAGGGAAATTTGACATCATCCCCACTATGATCAACATCGGCTCTGGCCTGGCACTGCTAGGCATGGCGACCGTGCTGTGTGACATCATAGTCCTCTACTGCATGAAGAAAAGACTCTACTATCGGGAGAAGAAATATAAATATGTGGAAGATTACGAGCAGGGTCTTGCTAGTGAGCTGGACCAGTGAGGCCTACCCCACACCTGGGCTCTCCACAGCCCCATCAAAGAACAGAGAGGAGGAGGAGGGAGAAATGGCCACCACATCACCCCAGAGAAATTTCTGGAATCTGATTGAGTCTCCACTCCACAAGCACTCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jun-Feng Huo et al.
Journal of cellular biochemistry, 120(4), 6322-6329 (2018-10-27)
Purinergic receptor P2X 4 (P2X4R), a member of purinergic channels family and a subtype of ionotropic adenosine triphosphate receptors, plays a critical role in tumorigenesis. Evidence suggested that P2X4R is expressed in rat C6 glioma model, however, its role and
Dmitry Aminin et al.
Scientific reports, 6, 39683-39683 (2016-12-23)
Since ancient times, edible sea cucumbers have been considered a jewel of the seabed and used in Asian folk medicine for stimulation of resistance against different diseases. However, the power of this sea food has not been established on a
Larisa Gofman et al.
Alcohol and alcoholism (Oxford, Oxfordshire), 51(6), 647-654 (2016-10-30)
Previously we have demonstrated altered microglia P2X4R expression in response to alcohol and pharmacological blockade with a selective P2X4R antagonist can reverse the action, suggesting that P2X4R play a role in mediating alcohol-induced effects on microglia. In the present study
Xiao-Hong Jin et al.
Journal of neuroscience research, 92(12), 1690-1702 (2014-07-06)
Previous studies have suggested that the microglial P2X7 purinoceptor is involved in the release of tumor necrosis factor-α (TNFα) following activation of toll-like receptor-4 (TLR4), which is associated with nociceptive behavior. In addition, this progress is evoked by the activation

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.