Direkt zum Inhalt
Merck

EHU066371

Sigma-Aldrich

MISSION® esiRNA

targeting human CARM1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCATGGGCTACATGCTCTTCAACGAGCGCATGCTGGAGAGCTACCTCCACGCCAAGAAGTACCTGAAGCCCAGCGGAAACATGTTTCCTACCATTGGTGACGTCCACCTTGCACCCTTCACGGATGAACAGCTCTACATGGAGCAGTTCACCAAGGCCAACTTCTGGTACCAGCCATCTTTCCATGGAGTGGACCTGTCGGCCCTCCGAGGTGCCGCGGTGGATGAGTATTTCCGGCAGCCTGTGGTGGACACATTTGACATCCGGATCCTGATGGCCAAGTCTGTCAAGTACACGGTGAACTTCTTAGAAGCCAAAGAAGGAGATTTGCACAGGATAGAAATCCCATTCAAATTCCACATGCTGCATTCAGGGCTGGTCCACGGCCTGGCTTTCTGGTTTGACGTTGCTTTCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Qiongjie Cao et al.
Eye and vision (London, England), 7, 35-35 (2020-08-09)
MicroRNAs (miRNAs) play critical roles in corneal development and functional homeostasis. Our previous study identified miR-184 as one of the most highly expressed miRNAs in the corneal epithelium. Even though its expression level plummeted dramatically during corneal epithelial wound healing
Cynthia M Quintero et al.
Journal of molecular biology, 430(21), 4168-4182 (2018-08-29)
Activation of the retinoic acid (RA) signaling pathway is important for controlling embryonic stem cell differentiation and development. Modulation of this pathway occurs through the recruitment of different epigenetic regulators at the retinoic acid receptors (RARs) located at RA-responsive elements
Priyanka Sharma et al.
Molecular cell, 73(1), 84-96 (2018-11-26)
The post-translational modification of key residues at the C-terminal domain of RNA polymerase II (RNAP2-CTD) coordinates transcription, splicing, and RNA processing by modulating its capacity to act as a landing platform for a variety of protein complexes. Here, we identify
Dongil Kim et al.
Cellular signalling, 26(9), 1774-1782 (2014-04-15)
Podocyte apoptosis induced by hyperglycemia is considered a critical factor in the development of diabetic nephropathy. Recent studies have implicated Notch signaling in podocyte apoptosis; however, its regulatory mechanisms are not fully understood. In this study, we found that high-glucose

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.