Direkt zum Inhalt
Merck

EHU065091

Sigma-Aldrich

MISSION® esiRNA

targeting human LAMP2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CACCACTGTGCCATCTCCTACTACAACACCTACTCCAAAGGAAAAACCAGAAGCTGGAACCTATTCAGTTAATAATGGCAATGATACTTGTCTGCTGGCTACCATGGGGCTGCAGCTGAACATCACTCAGGATAAGGTTGCTTCAGTTATTAACATCAACCCCAATACAACTCACTCCACAGGCAGCTGCCGTTCTCACACTGCTCTACTTAGACTCAATAGCAGCACCATTAAGTATCTAGACTTTGTCTTTGCTGTGAAAAATGAAAACCGATTTTATCTGAAGGAAGTGAACATCAGCATGTATTTGGTTAATGGCTCCGTTTTCAGCATTGCAAATAACAATCTCAGCTACTGGGATGCCCCCCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCATTTCAGATAAATACCTTTGATCTAAGGGTTCAGCCTTTCAATGTGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Anne-Sophie Bach et al.
Oncotarget, 6(29), 28084-28103 (2015-07-18)
The lysosomal protease cathepsin D (Cath-D) is overproduced in breast cancer cells (BCC) and supports tumor growth and metastasis formation. Here, we describe the mechanism whereby Cath-D is accumulated in the nucleus of ERα-positive (ER+) BCC. We identified TRPS1 (tricho-rhino-phalangeal-syndrome
Vikash Singh et al.
The Journal of biological chemistry, 292(5), 1847-1864 (2016-12-10)
Salmonella enterica are invasive intracellular pathogens that replicate within a membrane-bound compartment inside infected host cells known as the Salmonella-containing vacuole. How Salmonella obtains nutrients for growth within this intracellular niche despite the apparent isolation is currently not known. Recent
Chuan-Ying Xu et al.
Frontiers in aging neuroscience, 9, 308-308 (2017-10-13)
α-Synuclein misfolding and aggregation play an important role in the pathogenesis of Parkinson's disease (PD). Loss of function and mutation of the PARK7/DJ-1 gene cause early-onset familial PD. DJ-1 can inhibit α-synuclein aggregation, and may function at an early step
Anders P Mutvei et al.
Nature communications, 11(1), 1416-1416 (2020-03-19)
The kinase mTOR complex 1 (mTORC1) promotes cellular growth and is frequently dysregulated in cancers. In response to nutrients, mTORC1 is activated on lysosomes by Rag and Rheb guanosine triphosphatases (GTPases) and drives biosynthetic processes. How limitations in nutrients suppress

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.