Direkt zum Inhalt
Merck

EHU062201

Sigma-Aldrich

MISSION® esiRNA

targeting human EED

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGAAGTCAAAGAAATGCAAATATTCTTTCAAATGTGTAAATAGTCTCAAGGAAGATCATAACCAACCATTGTTTGGAGTTCAGTTTAACTGGCACAGTAAAGAAGGAGATCCATTAGTGTTTGCAACTGTAGGAAGCAACAGAGTTACCTTGTATGAATGTCATTCACAAGGAGAAATCCGGTTGTTGCAATCTTACGTGGATGCTGATGCTGATGAAAACTTTTACACTTGTGCATGGACCTATGATAGCAATACGAGCCATCCTCTGCTGGCTGTAGCTGGATCTAGAGGCATAATTAGGATAATAAATCCTATAACAATGCAGTGTATAAAGCACTATGTTGGCCATGGAAATGCTATCAATGAGCTGAAATTCCATCCAAGAGATCCAAATCTTCTCCTGTCAGTAAGTAAAGATCATGCTTTACGATTATGGAATATCCAGACGGACACTCTGGTGGCAATATTTGGAGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Bing He et al.
Oncotarget, 8(61), 103919-103930 (2017-12-22)
The miRNAs play important regulating roles in the pathogenesis of hepatocellular carcinoma (HCC). To uncover key regulating miRNAs in HCC that were neglected by traditional analyzing methods of transcriptomics data, we proposed a novel molecular-network-based omics' (MNBO) method. With this
Houliang Deng et al.
Scientific reports, 9(1), 197-197 (2019-01-19)
Chromobox 6 (CBX6) is a subunit of Polycomb Repressive Complex 1 (PRC1) that mediates epigenetic gene repression and acts as an oncogene or tumor suppressor in a cancer type-dependent manner. The specific function of CBX6 in breast cancer is currently
Qipeng Liu et al.
International journal of cancer, 145(2), 415-426 (2019-01-11)
Polycomb group proteins are important epigenetic regulators for cell proliferation and differentiation, organ development, as well as initiation and progression of lethal diseases, including cancer. Upregulated Polycomb group proteins, including Enhancer of zeste homolog 2 (EZH2), promote proliferation, migration, invasion
Seong Won Lee et al.
Developmental cell, 46(1), 73-84 (2018-07-06)
The ability to convert human somatic cells efficiently to neurons facilitates the utility of patient-derived neurons for studying neurological disorders. As such, ectopic expression of neuronal microRNAs (miRNAs), miR-9/9∗ and miR-124 (miR-9/9∗-124) in adult human fibroblasts has been found to
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.