Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU048411

Sigma-Aldrich

MISSION® esiRNA

targeting human WRN

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCCACGGAGGGTTTCTATCTTACTAAAGGATATTTCAGAAAATCTATATTCACTGAGGAGGATGATAATTGGGTCTACTAACATTGAGACTGAACTGAGGCCCAGCAATAATTTAAACTTATTATCCTTTGAAGATTCAACTACTGGGGGAGTACAACAGAAACAAATTAGAGAACATGAAGTTTTAATTCACGTTGAAGATGAAACATGGGACCCAACACTTGATCATTTAGCTAAACATGATGGAGAAGATGTACTTGGAAATAAAGTGGAACGAAAAGAAGATGGATTTGAAGATGGAGTAGAAGACAACAAATTGAAAGAGAATATGGAAAGAGCTTGTTTGATGTCGTTAGATATTACAGAACATGAACTCCAAATTTTGGAACAGCAGTCTCAGGA

Ensembl | Human Hinterlegungsnummer

ENSG00000165392

NCBI-Hinterlegungsnummer

NM_000553

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... WRN(7486) , WRN(7486)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jyotirindra Maity et al.
DNA repair, 68, 1-11 (2018-05-26)
Impaired autophagy may be associated with normal and pathological aging. Here we explore a link between autophagy and domain function of Werner protein (WRNp). Werner (WRN) mutant cell lines AG11395, AG05229 and normal aged fibroblast AG13129 display a deficient response
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Edmond M Chan et al.
Nature, 568(7753), 551-556 (2019-04-12)
Synthetic lethality-an interaction between two genetic events through which the co-occurrence of these two genetic events leads to cell death, but each event alone does not-can be exploited for cancer therapeutics1. DNA repair processes represent attractive synthetic lethal targets, because
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific
Venkateswarlu Popuri et al.
Nucleic acids research, 42(9), 5671-5688 (2014-03-14)
A variety of human tumors employ alternative and recombination-mediated lengthening for telomere maintenance (ALT). Human RecQ helicases, such as BLM and WRN, can efficiently unwind alternate/secondary structures during telomere replication and/or recombination. Here, we report a novel role for RECQL1
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.