Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU044171

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCGCTTCAGACATGAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTGAAGACACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTACCAGATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCAAGATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCACACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAATTATGTTGAATTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTGTAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCATCTTTCCA

Ensembl | Human Hinterlegungsnummer

ENSG00000100030

NCBI-Hinterlegungsnummer

NM_002745

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MAPK1(5594) , MAPK1(5594)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jian Zhang et al.
Experimental & molecular medicine, 49(9), e379-e379 (2017-09-25)
The objective of this study was to investigate the regulatory effects of TGF-β1 on CCL3/4 expression and inflammation-related pain during intervertebral disc degeneration (IVDD). TGF-β1 and CCL3/4 expression patterns in different degenerative human nucleus pulposus (NP) tissues were measured by
Li-Li Xu et al.
Oxidative medicine and cellular longevity, 2018, 3271617-3271617 (2018-06-12)
Ulcerative colitis (UC) is a common inflammatory bowel disease that can destroy the integrity of the colon and increase the risk of colorectal cancer. Oxidative stress is one of the critical pathogenic factors for UC, further impairing the entire affected
Susanne Ulm et al.
Journal of molecular and cellular cardiology, 72, 104-116 (2014-03-19)
Mitogen-activated protein kinases (MAPKs) are involved in the regulation of cardiac hypertrophy and myocyte survival. Extracellular signal regulated protein kinase 1 and 2 (ERK1/2) are key components in the MAPK signaling pathways. Dysfunction of ERK1/2 in congenital heart diseases (Noonan
Bishuang Cai et al.
Science signaling, 11(549) (2018-09-27)
Inflammation resolution counterbalances excessive inflammation and restores tissue homeostasis after injury. Failure of resolution contributes to the pathology of numerous chronic inflammatory diseases. Resolution is mediated by endogenous specialized proresolving mediators (SPMs), which are derived from long-chain fatty acids by
Vijay G Ramakrishnan et al.
Haematologica, 104(10), 2061-2074 (2019-03-09)
Despite recent advances in the treatment of multiple myeloma, patients with this disease still inevitably relapse and become refractory to existing therapies. Mutations in K-RAS, N-RAS and B-RAF are common in multiple myeloma, affecting 50% of patients at diagnosis and
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.