Direkt zum Inhalt
Merck

EHU043821

Sigma-Aldrich

MISSION® esiRNA

targeting human RB1CC1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGGCCAAGATTCCACTGTTGGAGTGCCTAACCAGACATAGTTACAGAGAATGTTTGGGAAGACTGGATTCTTTACCTGAACATGAAGACTCAGAAAAAGCTGAGATGAAAAGATCCACTGAACTGGTGCTCTCTCCTGATATGCCTAGAACAACTAACGAATCTTTGTTAACCTCATTTCCCAAGTCAGTGGAACATGTGTCCCCAGATACCGCAGATGCTGAAAGTGGCAAAGAAATTAGGGAATCTTGTCAAAGTACTGTTCATCAGCAAGATGAAACTACGATTGACACTAAAGATGGTGATCTGCCCTTTTTTAATGTCTCTTTGTTAGACTGGATAAATGTTCAAGATAGACCTAATGATGTGGAATCTTTGGTCAGGAAGTGCTTTGATTCTATGAGCAGGCTTGATCCAAGGATTATTCGACCATTTATAGCAGAATGCCGTCAAACTATTGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ingrid Kjos et al.
EMBO reports, 18(10), 1727-1739 (2017-08-25)
Autophagy (macroautophagy) is a highly conserved eukaryotic degradation pathway in which cytosolic components and organelles are sequestered by specialized autophagic membranes and degraded through the lysosomal system. The autophagic pathway maintains basal cellular homeostasis and helps cells adapt during stress;
Aykut Turan et al.
The Journal of cell biology, 218(2), 508-523 (2018-12-28)
Dendritic cells (DCs) are crucial for the induction of potent antiviral immune responses. In contrast to immature DCs (iDCs), mature DCs (mDCs) are not permissive for infection with herpes simplex virus type 1 (HSV-1). Here, we demonstrate that HSV-1 infection
Eleonora Turco et al.
Molecular cell, 74(2), 330-346 (2019-03-12)
The autophagy cargo receptor p62 facilitates the condensation of misfolded, ubiquitin-positive proteins and their degradation by autophagy, but the molecular mechanism of p62 signaling to the core autophagy machinery is unclear. Here, we show that disordered residues 326-380 of p62
Takashi Nozawa et al.
Nature communications, 11(1), 770-770 (2020-02-09)
Invading microbial pathogens can be eliminated selectively by xenophagy. Ubiquitin-mediated autophagy receptors are phosphorylated by TANK-binding kinase 1 (TBK1) and recruited to ubiquitinated bacteria to facilitate autophagosome formation during xenophagy, but the molecular mechanism underlying TBK1 activation in response to
Tomokazu Murakawa et al.
Cell reports, 26(2), 338-345 (2019-01-10)
Degradation of mitochondria by selective autophagy, termed mitophagy, contributes to the control of mitochondrial quality. Bcl2-L-13 is a mammalian homolog of Atg32, which is an essential mitophagy receptor in yeast. However, the molecular machinery involved in Bcl2-L-13-mediated mitophagy remains to

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.