Direkt zum Inhalt
Merck

EHU037061

Sigma-Aldrich

MISSION® esiRNA

targeting human SALL4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCAGAAAGTGAGGGTGGACCCACACTCCCTGGGGTGGGACCAAACTATAATTCCCCAAGGGCTGGTGGCTTCCAAGGGAGTGGGACCCCTGAGCCAGGGTCAGAGACCCTGAAATTGCAGCAGTTGGTGGAGAACATTGACAAGGCCACCACTGATCCCAACGAATGTCTCATTTGCCACCGAGTCTTAAGCTGTCAGAGCTCCCTCAAGATGCATTATCGCACCCACACCGGGGAGAGACCGTTCCAGTGTAAGATCTGTGGCCGAGCCTTTTCTACCAAAGGTAACCTGAAGACACACCTTGGGGTTCACCGAACCAACACATCCATTAAGACGCAGCATTCGTGCCCCATCTGCCAGAAGAAGTTCACTAATGCCGTGATGCTGCAGCAACATATTCGGATGCACA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kol Jia Yong et al.
Oncotarget, 7(46), 75425-75440 (2016-10-06)
The overall survival of lung cancer patients remains dismal despite the availability of targeted therapies. Oncofetal protein SALL4 is a novel cancer target. We herein report that SALL4 was aberrantly expressed in a subset of lung cancer patients with poor
Dengfeng Zhang et al.
Oncology research, 25(5), 763-771 (2016-12-17)
Sal-like protein 4 (SALL4) is a zinc finger transcription factor that has been reported to be aberrantly expressed in several human malignancies and identified as an oncogene. However, the potential role of SALL4 in osteosarcoma remains to be elucidated. In
Amireza Hesari et al.
Journal of cellular biochemistry, 120(6), 9392-9399 (2018-12-07)
Breast cancer is the most prevalent cancers worldwide and causes a significant amount of deaths annually. Spalt-like transcription factor 4 is known as a transcription factor, which has an important role in the proliferation of cancerous cells. Small interfering RNA
Mei Wang et al.
Journal of cellular biochemistry, 120(9), 15027-15037 (2019-04-23)
MicroRNAs (miRNAs) play pivotal roles in modulating key biological processes in gastric cancer (GC). As a newly identified miRNA, the function and potential mechanism of miR-188-5p in GC has not been thoroughly elucidated. Here, quantitative real-time polymerase chain reaction detection
AmirReza Hesari et al.
Journal of cellular biochemistry (2019-02-17)
Colorectal cancer (CRC) is known as the third most common malignancies among men and women and is also the second leading cause of cancer-related deaths worldwide. It has been indicated that a variety of risk factors are involved in the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.