Direkt zum Inhalt
Merck

EHU035471

Sigma-Aldrich

MISSION® esiRNA

targeting human PNPLA2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGTGCCAAGTTCATTGAGGTATCTAAAGAGGCCCGGAAGCGGTTCCTGGGCCCCCTGCACCCCTCCTTCAACCTGGTAAAGATCATCCGCAGTTTCCTGCTGAAGGTCCTGCCTGCTGATAGCCATGAGCATGCCAGTGGGCGCCTGGGCATCTCCCTGACCCGCGTGTCAGACGGCGAGAATGTCATTATATCCCACTTCAACTCCAAGGACGAGCTCATCCAGGCCAATGTCTGCAGCGGTTTCATCCCCGTGTACTGTGGGCTCATCCCTCCCTCCCTCCAGGGGGTGCGCTACGTGGATGGTGGCATTTCAGACAACCTGCCACTCTATGAGCTTAAGAACACCATCACAGTGTCCCCCTTCTCGGGCGAGAGTGACATCTGTCCGCAGGACAGCTCCACCAACATC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yosuke Kanno et al.
Arthritis research & therapy, 19(1), 22-22 (2017-02-06)
Systemic sclerosis (SSc) is a connective tissues disease of unknown origin characterized by vascular damage and extensive fibrosis. Recently, we demonstrated that α2-antiplasmin (α2AP) is associated with the development of fibrosis in SSc. We herein investigate the roles of α2AP
Monika Riederer et al.
Archives of physiology and biochemistry, 123(4), 249-253 (2017-04-04)
Vascular endothelial cells represent an important source of arachidonic acid (AA)-derived mediators involved in the generation of anti- or proatherogenic environments. Evidence emerged (in mast cells), that in addition to phospholipases, neutral lipid hydrolases as adipose triglyceride lipase (ATGL) also
Tian Ma et al.
International journal of oncology, 42(5), 1743-1753 (2013-04-03)
The G0/G1 switch gene 2 (G0S2) is rapidly induced by all-trans-retinoic acid (RA)-treatment of acute promyelocytic leukemia (APL) and other cells. G0S2 regulates lipolysis via inhibition of adipose triglyceride lipase (ATGL). This study found that retinoic acid receptor (RAR), but
Susanne Bürger et al.
International journal of molecular sciences, 22(1) (2021-01-06)
The demise of retinal ganglion cells (RGCs) is characteristic of diseases of the retina such as glaucoma and diabetic or ischemic retinopathies. Pigment epithelium-derived factor (PEDF) is a multifunctional secreted protein that mediates neuroprotection and inhibition of angiogenesis in the
Ping Xie et al.
Endocrinology, 156(5), 1648-1658 (2015-03-10)
Intramyocellular accumulation of lipids is often associated with insulin resistance. Deficiency of comparative gene identification-58 (CGI-58) causes cytosolic deposition of triglyceride (TG)-rich lipid droplets in most cell types, including muscle due to defective TG hydrolysis. It was unclear, however, whether

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.