Direkt zum Inhalt
Merck

EHU035131

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACACACATCAAGACAGAACCTGTTGCCATTTTCAGCCACCAGAGTGAAACGACTGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCTGAGTTCACCAGTATATTCAGCTCACACCAGACCGCAGCTCCAGAGGTGAACAATATTTTCATCAAACAAGAACTTCCTACACCAGATCTTCATCTTTCTGTCCCTACCCAGCAGGGCCACCTGTACCAGCTACTGAATACACCGGATCTAGATATGCCCAGTTCTACAAATCAGACAGCAGCAATGGACACTCTTAATGTTTCTATGTCAGCTGCCATGGCAGGCCTTAACACACACACCTCTGCTGTTCCGCAGACTGCAGTGAAACAATTCCAGGGCAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

P Chen et al.
European review for medical and pharmacological sciences, 24(8), 4224-4231 (2020-05-07)
This study aims to investigate the expression characteristics of Krüppel-like factor 5 (KLF5) in gastric cancer (GC) and its potential correlation to pathological indexes in GC patients. Molecular mechanisms underlying the regulatory effect of KLF5 on GC progression are explored.
Kaixin Wangzhou et al.
Frontiers in physiology, 11, 606967-606967 (2021-02-20)
Human periodontal ligament cells (hPDLCs) play a vital role in cell regeneration and tissue repair with multi-directional differentiation potential. microRNAs (miRs) are implicated in the osteogenesis of hPDLCs. This study explored the mechanism of miR-143-3p in osteogenesis of hPDLCs. Osteogenic
Yubo Liu et al.
Nature communications, 11(1), 5898-5898 (2020-11-21)
O-GlcNAc modification plays critical roles in regulating the stress response program and cellular homeostasis. However, systematic and multi-omics studies on the O-GlcNAc regulated mechanism have been limited. Here, comprehensive data are obtained by a chemical reporter-based method to survey O-GlcNAc
Yan-Yi Jiang et al.
Gastroenterology, 159(4), 1311-1327 (2020-07-04)
We investigated the transcriptome of esophageal squamous cell carcinoma (ESCC) cells, activity of gene regulatory (enhancer and promoter regions), and the effects of blocking epigenetic regulatory proteins. We performed chromatin immunoprecipitation sequencing with antibodies against H3K4me1, H3K4me3, and H3K27ac and
Xiaolong Wei et al.
Oncotarget, 8(65), 109301-109318 (2018-01-10)
Achaete scute-like 2 (Ascl2) is the Wnt signaling target, its regulation by other signaling is undefined. Now we demonstrated that CD133+/CD44+ cell population from HT-29 or Caco-2 cells exhibited cancer stem cell (CSC) properties with highly expressed Ascl2, which is

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.