Direkt zum Inhalt
Merck

EHU031761

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGGGTCTGCTTGTGTTCAATGCCTCAGACAGGTTCGAAGGCATCACCACGCTGCCCAATATCACAGTTACTGACTATCCCAAACAGATCTTCAGGGTGAAAACCACCCAGTTTACATGGACTGAAATGCTAATTATGGTCTGGGTTCTTGGAATGATGTGGTCTGAATGTAAAGAGCTCTGGCTGGAAGGACCTAGGGAATACATTTTGCAGTTGTGGAATGTGCTTGACTTTGGGATGCTGTCCATCTTCATTGCTGCTTTCACAGCCAGATTCCTAGCTTTCCTTCAGGCAACGAAGGCACAACAGTATGTGGACAGTTACGTCCAAGAGAGTGACCTCAGTGAAGTGACACTCCCACCAGAGATACAGTATTTCACTTATGCTAGAGATAAATGGCTCCCTTCTGACCCTCAGATTATATCTGAAGGCCTTTATGCCATAGCTGTTGTGCTCAGCTTCTCTCGGATTGCGTAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lingwei Wang et al.
Biochemical and biophysical research communications, 484(1), 209-217 (2016-12-31)
Airway hyperresponsiveness (AHR), airway remodeling and inflammation are the fundamental pathological alterations that occur in asthma. Transient receptor potential canonical 3 (TRPC3) has been implicated in diverse functions of airway smooth muscle cells (ASMCs) in asthma. However, the underlying mechanisms
Xiaoyu Zhang et al.
Journal of cellular biochemistry, 119(7), 6033-6044 (2018-03-27)
This study aimed to validate whether transient receptor potential channel1 (TRPC1) and TRPC3 participate in the regulation the proliferation of airway smooth muscle cells (ASMCs) through modulating calcium ion (Ca2+ ) influx in vitro. Chronic model of murine asthma was
Xiao-Xu Chen et al.
Life sciences, 187, 64-73 (2017-08-15)
Canonical transient receptor potential channel-3 (TRPC3)-encoded Ca Primary mouse ASMCs were cultured with or without ACh treatment, then cell viability, TRPC3 expression, NSCC currents and [Ca TRPC3 blocker Gd Our data suggested ACh could induce ASMC proliferation, and TRPC3 may
Pengzhou Hang et al.
International journal of biological sciences, 11(5), 536-545 (2015-04-22)
Brain-derived neurotrophic factor (BDNF) is associated with coronary artery diseases. However, its role and mechanism in myocardial infarction (MI) is not fully understood. Wistar rat and Kunming mouse model of MI were induced by the ligation of left coronary artery.
Kexin Meng et al.
PloS one, 9(6), e98777-e98777 (2014-06-07)
Calcium-sensing receptor (CaSR) has been demonstrated to be present in several tissues and cells unrelated to systemic calcium homeostasis, where it regulates a series of diverse cellular functions. A previous study indicated that CaSR is expressed in mouse glomerular mesangial

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.