Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU028861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1R

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGAATAACATTGCTTCAGAGCTGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAGAAGGGAATTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCGGTA

Ensembl | Human Hinterlegungsnummer

ENSG00000140443

NCBI-Hinterlegungsnummer

NM_000875

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... IGF1R(3480) , IGF1R(3480)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lu Chen et al.
OncoTargets and therapy, 12, 907-919 (2019-02-19)
A variety of microRNAs (miRNAs) are aberrantly expressed in acute myeloid leukemia (AML), and these dysregulated miRNAs perform crucial roles in tumorigenesis and progression of AML. miR-628-3p (miR-628), one of the miRNAs dysregulated in multiple types of human cancers, exerts
Bao-Feng Li et al.
Human cell, 30(4), 311-318 (2017-08-11)
In recent years, some studies have been made on the effects of circular RNA (circRNA) in osteoarthritis (OA) and so on; however, its mechanisms remain to be further explored. Studies have shown that tumor necrosis factor-alpha can inhibit hsa_circ_0045714 expression
Tomokazu Ohnuma et al.
Archives of biochemistry and biophysics, 635, 66-73 (2017-10-21)
Many lines of evidence demonstrate that transcription factor nuclear factor-E2-related factor 2 (Nrf2) plays essential roles in cancer cell proliferation and resistance to chemotherapy, thereby indicating that suppression of abnormal Nrf2 activation is needed for a new therapeutic approach. Our
Li-Li Mei et al.
Cancer biomarkers : section A of Disease markers, 20(4), 527-537 (2017-08-12)
miR-99a is down-regulated in esophageal squamous cell carcinoma (ESCC), however the role and underlying mechanism are still unknown. We aim to explore the role and mechanism of miR-99a down-regulation in ESCC. The expression of miR-99a in ESCC tissues and cell
Yann Neuzillet et al.
BMC cancer, 17(1), 636-636 (2017-09-09)
The insulin growth factor (IGF) pathway has been proposed as a potential therapeutic target in bladder cancer. We characterized the expression of components of the IGF pathway - insulin growth factor receptors (INSR, IGF1R, IGF2R), ligands (INS, IGF1, IGF2), and
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.