Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU027961

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTTCTCCTCAGCAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGCGGTGCGATGGGTTTACTGAATGTGAAGACCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTATTGATGGTGCCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTTTAATTGATCAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGTGACAAGTCAGATGAACTGGATTGTTATCCGACTGAAGAACCAGCACCACAG

Ensembl | Human Hinterlegungsnummer

ENSG00000070018

NCBI-Hinterlegungsnummer

NM_002336

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LRP6(4040) , LRP6(4040)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xu Luo et al.
Neuroscience bulletin, 36(10), 1171-1181 (2020-06-21)
Neuronal apoptosis is one of the essential mechanisms of early brain injury after subarachnoid hemorrhage (SAH). Recently, HLY78 has been shown to inhibit apoptosis in tumor cells and embryonic cells caused by carbon ion radiation through activation of the Wnt/β-catenin
Jiaqi Xu et al.
Oncology letters, 14(5), 5638-5642 (2017-11-04)
The third member of the Dickkopf family (DKK-3), also known as reduced expression in immortalized cells (REIC), is a tumor suppressor present in a variety of tumor cells. Regarding the regulation of the Wnt/β-catenin signaling pathway, exogenous DKK-1 and DKK-2
Han Zhou et al.
JCI insight, 5(3) (2020-02-14)
Vascular inflammation is present in many cardiovascular diseases, and exogenous glucocorticoids have traditionally been used as a therapy to suppress inflammation. However, recent data have shown that endogenous glucocorticoids, acting through the endothelial glucocorticoid receptor, act as negative regulators of
Lei Wang et al.
Bone research, 6, 22-22 (2018-07-25)
Low-density lipoprotein receptor-related protein 6 (LRP6) is a co-receptor for Wnt signaling and can be recruited by multiple growth factors/hormones to their receptors facilitating intracellular signaling activation. The ligands that bind directly to LRP6 have not been identified. Here, we
Toshiaki Teratani et al.
The Journal of clinical investigation, 128(4), 1581-1596 (2018-03-20)
Incidence of nonalcoholic steatohepatitis (NASH), which is considered a hepatic manifestation of metabolic syndrome, has been increasing worldwide with the rise in obesity; however, its pathological mechanism is poorly understood. Here, we demonstrate that the hepatic expression of aortic carboxypeptidase-like
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.