Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU027651

Sigma-Aldrich

MISSION® esiRNA

targeting human SQSTM1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGAACGTTGGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGACCCCAGCAAGCCGGGTGGGAATGTTGAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGTCCGAGGGGCGCCCTGAGGCAATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCATCTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTACCCACATCTCCCGCCAGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATG

Ensembl | Human Hinterlegungsnummer

ENSG00000161011

NCBI-Hinterlegungsnummer

NM_003900

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SQSTM1(8878) , SQSTM1(8878)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Akihito Arai et al.
American journal of cancer research, 7(4), 881-891 (2017-05-05)
Hypopharyngeal carcinoma is one of the worst prognostic malignancies among head and neck carcinomas. Therefore, a good biomarker should be identified to predict the best therapeutic option before starting the treatment. In cell models, p62/SQSTM1 levels affected the Nrf2-Keap1 pathway
Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal
Prasun Guha et al.
Oncotarget, 8(40), 68191-68207 (2017-10-06)
Studies suggest that tunicamycin may work as a therapeutic drug to cancer cells by inducing stress in the endoplasmic reticulum (ER) through unfolded protein response (UPR) and thereby promoting apoptosis. However, mechanisms of the prolonged activation of the UPR under
Haofeng Ning et al.
Experimental and therapeutic medicine, 14(6), 5417-5423 (2017-12-30)
Macrophage autophagy has a protective role in the development of atherosclerosis; however, it turns dysfunctional in advanced lesions with an increase in p62/sequestosome-1 protein. Little is known about the role and significance of p62 accumulation in atherosclerosis. The present study
Arishya Sharma et al.
Autophagy, 14(11), 1976-1990 (2018-07-12)
Recent reports have made important revelations, uncovering direct regulation of DNA damage response (DDR)-associated proteins and chromatin ubiquitination (Ubn) by macroautophagy/autophagy. Here, we report a previously unexplored connection between autophagy and DDR, via a deubiquitnase (DUB), USP14. Loss of autophagy
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.