Direkt zum Inhalt
Merck

EHU024041

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAGCTTCCTGGAGACTTTGAAGACAGAGCGGCTGAGCCCAGACCTCCTGACCCTGGGACCTGCACTGCCTTCATCACTCCCTGTCCCCAATAGTGCTTATGGGGGCCCTGACTTTTCCAGTACCTTCTTTTCTCCCACCGGGAGCCCCCTCAATTCAGCAGCCTATTCCTCTCCCAAGCTTCGTGGAACTCTCCCCCTGCCTCCCTGTGAGGCCAGGGAGTGTGTGAACTGCGGAGCAACAGCCACTCCACTGTGGCGGAGGGACAGGACAGGCCACTACCTATGCAACGCCTGCGGCCTCTATCACAAGATGAATGGGCAGAACAGGCCCCTCATCCGGCCCAAGAAGCGCCTGATTGTCAGTAAACGGGCAGGTACTCAGTGCACCAACTGCCAGACGACCACCACGACACTGTGGCGGAGAAATGCCAGTGGGGATCCCGTGTGCAATGCCTGCGGCCTCTACTACAAGCTACACCAGGTGAACCG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Leider sind derzeit keine COAs für dieses Produkt online verfügbar.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Miranda L Xu et al.
Journal of neurochemistry, 146(4), 390-402 (2018-04-21)
Acetylcholinesterase (AChE; EC 3.1.1.7) is known to hydrolyze acetylcholine at cholinergic synapses. In mammalian erythrocyte, AChE exists as a dimer (G2 ) and is proposed to play role in erythropoiesis. To reveal the regulation of AChE during differentiation of erythroblast
Anouck Wijgaerts et al.
Haematologica, 102(4), 695-706 (2017-01-14)
Gray platelet syndrome is named after the gray appearance of platelets due to the absence of α-granules. It is caused by recessive mutations in
Pavel Burda et al.
PloS one, 11(3), e0152234-e0152234 (2016-03-25)
GATA-1 and PU.1 are two important hematopoietic transcription factors that mutually inhibit each other in progenitor cells to guide entrance into the erythroid or myeloid lineage, respectively. PU.1 controls its own expression during myelopoiesis by binding to the distal URE
A Maroz et al.
Leukemia, 28(6), 1259-1270 (2013-12-18)
Transient leukemia (TL) is evident in 5-10% of all neonates with Down syndrome (DS) and associated with N-terminal truncating GATA1 mutations (GATA1s). Here we report that TL-cell clones generate abundant eosinophils in a substantial fraction of patients. Sorted eosinophils from
John Timothy Caldwell et al.
PloS one, 8(7), e68601-e68601 (2013-07-23)
It has been previously shown that acute myeloid leukemia (AML) patients with higher levels of GATA1 expression have poorer outcomes. Furthermore, pediatric Down syndrome (DS) patients with acute megakaryocytic leukemia (AMKL), whose blast cells almost universally harbor somatic mutations in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.