Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU022031

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGCCAAAGCCACTATCCTGTGGGACAATGCCTTCTCTGAGATGGACCGCGTGCCCTTTGTGGTGGCTGAGCGGGTGCCCTGGGAGAAGATGTGTGAAACTCTGAACCTGAAGTTCATGGCTGAGGTGGGGACCAACCGGGGGCTGCTCCCAGAGCACTTCCTCTTCCTGGCCCAGAAGATCTTCAATGACAACAGCCTCAGTATGGAGGCCTTCCAGCACCGTTCTGTGTCCTGGTCGCAGTTCAACAAGGAGATCCTGCTGGGCCGTGGCTTCACCTTTTGGCAGTGGTTTGATGGTGTCCTGGACCTCACCAAACGCTGTCTCCGGAGCTACTGGTCTGACCGGCTGATCATTGGCTTCATCAGCAAACAGTACGTTACTAGCCTTCTTCTCAATGAGCCCGACGGAACCTTTCTCCTCCGCTTCAGCGACTCAGAGATTGGGGGCATCACCATTGCCCATGTCATCCGGGGCCAGGATGGCTCTCCACAGAT

Ensembl | Human Hinterlegungsnummer

ENSG00000166888

NCBI-Hinterlegungsnummer

NM_003153

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... STAT6(6778) , STAT6(6778)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tian Qing et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 1-6 (2017-05-20)
Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC)
Zachary P McKay et al.
Journal of immunology (Baltimore, Md. : 1950), 206(6), 1385-1394 (2021-01-29)
Crosstalk between costimulatory and coinhibitory ligands are a prominent node of immune cell regulation. Mounting evidence points toward a critical role for CD155, the poliovirus receptor, in suppressing T cell function, particularly in cancer. However, relative to other known costimulatory/coinhibitory
Li Yang et al.
Cellular & molecular immunology, 13(5), 669-677 (2015-07-21)
The etiology and the underlying mechanism of CD4(+) T-cell polarization are unclear. This study sought to investigate the mechanism by which interleukin (IL)-13 prevents the activation-induced apoptosis of CD4(+) T cells. Here we report that CD4(+) T cells expressed IL-13
Kristine C Olson et al.
Cytokine, 111, 551-562 (2018-11-21)
Calcitriol, the active form of vitamin D, has been well documented to act directly on immune cells and malignant cells. Activated T cells are one of the best characterized targets of calcitriol, with effects including decreasing inflammatory cytokine output and
Noelia Keiran et al.
Nature immunology, 20(5), 581-592 (2019-04-10)
Succinate is a signaling metabolite sensed extracellularly by succinate receptor 1 (SUNCR1). The accumulation of succinate in macrophages is known to activate a pro-inflammatory program; however, the contribution of SUCNR1 to macrophage phenotype and function has remained unclear. Here we
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.