Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU020151

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM9

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGGCGGGATTAATGTGTTTGGACAAATCACTGTGGAGACATTTGCTTCCATTGTTGCTCATGAATTGGGTCATAATCTTGGAATGAATCACGATGATGGGAGAGATTGTTCCTGTGGAGCAAAGAGCTGCATCATGAATTCAGGAGCATCGGGTTCCAGAAACTTTAGCAGTTGCAGTGCAGAGGACTTTGAGAAGTTAACTTTAAATAAAGGAGGAAACTGCCTTCTTAATATTCCAAAGCCTGATGAAGCCTATAGTGCTCCCTCCTGTGGTAATAAGTTGGTGGACGCTGGGGAAGAGTGTGACTGTGGTACTCCAAAGGAATGTGAATTGGACCCTTGCTGCGAAGGAAGTACCTGTAAGCTTAAATCATTTGCTGAGTGTGCATATGGTGACTGTTGTAAAGACTGTCGGTTCCTTCCA

Ensembl | Human Hinterlegungsnummer

ENSG00000168615

NCBI-Hinterlegungsnummer

NM_003816

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... ADAM9(8754) , ADAM9(8754)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rui Zhou et al.
Frontiers in medicine, 7, 214-214 (2020-07-09)
Upregulation of a disintegrin and metalloprotease 9 (ADAM9) is correlated with progression of cancers, such as prostate, bladder, and pancreatic cancers. However, its role in triple-negative breast cancer (TNBC) is still unclear. Our study aimed to investigate whether ADAM9 is
Jun Arai et al.
Journal of gastroenterology and hepatology, 33(5), 1075-1081 (2017-10-22)
The multi-kinase inhibitor regorafenib (REG) was recently demonstrated to be effective in patients with sorafenib (SOR)-resistant hepatocellular carcinoma (HCC). Interestingly, SOR is known to enhance the accumulation of membrane-bound MHC class I polypeptide-related sequence A (mMICA) in HCC cells and
Mari Ueno et al.
Cancer science, 109(2), 471-482 (2017-12-17)
ADAMs (a disintegrin and metalloproteinases) are involved in various biological events such as cell adhesion, migration and invasion, membrane protein shedding and proteolysis. However, there have been no systematic studies on the expression of ADAMs in human ovarian carcinomas. We
Liang Chang et al.
Molecular medicine reports, 12(1), 1197-1204 (2015-03-18)
A disintegrin and metalloproteinase 9 (ADAM9) is a type I transmembrane protein that has been associated with cancer development and metastasis in various types of cancer. However, little is known about its role in non-small cell lung cancer (NSCLC). The
Kenzo Sonoda et al.
BioMed research international, 2014, 482396-482396 (2014-09-02)
In several human malignancies, the expression of receptor-binding cancer antigen expressed on SiSo cells (RCAS1) is associated with aggressive characteristics and poor overall survival. RCAS1 alters the tumor microenvironment by inducing peripheral lymphocyte apoptosis and angiogenesis, while reducing the vimentin-positive

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.