Direkt zum Inhalt
Merck

EHU020001

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCTCACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTGGATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAAGAGTGGGAGTTCGAGGTGACAGCCTTCTACCG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiao-Hua Wang et al.
The international journal of biochemistry & cell biology, 87, 8-17 (2017-03-25)
Respiratory syncytial virus (RSV) is the leading cause of bronchiolitis in infancy, which is a major risk factor for recurrent wheezing and asthma. Orosomucoid 1-like protein 3 (ORMDL3) has been reported to associate with virus-triggered recurrent wheezing and asthma in
Nanae Harashima et al.
Molecular cancer, 13, 217-217 (2014-09-18)
Synthetic double-stranded RNA poly(I:C) is a useful immune adjuvant and exhibits direct antitumor effects against several types of cancers. In this study, we elucidated the mechanisms underlying the effects induced in poly(I:C)-transfected human renal cell carcinoma (RCC) cells. In contrast
Danielle N Kroetz et al.
PLoS pathogens, 11(12), e1005338-e1005338 (2015-12-29)
Influenza A virus (IAV) is an airborne pathogen that causes significant morbidity and mortality each year. Macrophages (Mϕ) are the first immune population to encounter IAV virions in the lungs and are required to control infection. In the present study
Iris F Ueki et al.
The Journal of experimental medicine, 210(10), 1929-1936 (2013-09-04)
Viruses suppress host responses to increase infection, and understanding these mechanisms has provided insights into cellular signaling and led to novel therapies. Many viruses (e.g., Influenza virus, Rhinovirus [RV], Cytomegalovirus, Epstein-Barr virus, and Hepatitis C virus) activate epithelial epidermal growth
Koji Hirono et al.
Modern rheumatology, 30(6), 1074-1081 (2019-10-19)
Background: Endothelial expression of membrane-bound fractalkine/CX3CL1 (Fkn) reportedly acts as a strong mediator of inflammation. Toll-like receptor 3 (TLR3) axes are thought to play some roles in the development of chronic glomerulonephritis (CGN) including lupus nephritis (LN). However, detailed mechanism

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.