Direkt zum Inhalt
Merck

EHU015351

Sigma-Aldrich

MISSION® esiRNA

targeting human AIM2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGGTGTCTGCAGTGATGAAGACCATTCGTATTTTTCAGAAGTTGAATTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGATAAGCAATACAAATCGGTAACAAAACCAAAGCCACTAAGTCAAGCTGAAATGAGTCCTGCTGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGTCTCTCCTCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTTTCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTTTGAGACCCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATTCTTCTTTGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAATTATAATAGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

N Yoon et al.
Cell death & disease, 7, e2191-e2191 (2016-04-15)
Our recent study showed that human mesenchymal stem/stromal cells (hMSCs) are activated to express tumor necrosis factor (TNF)-α-related apoptosis-inducing ligand (TRAIL) by exposure to TNF-α and these activated hMSCs effectively induce apoptosis in triple-negative breast cancer MDA-MB-231 (MDA) cells in
Minda Zhang et al.
Journal of cellular physiology, 234(11), 20161-20173 (2019-04-07)
The human absent in melanoma 2 (AIM2) is considered as a DNA recognizer. AIM2 has been described as a tumor suppressor gene in the early years. But recent studies suggested that it functions as an oncogene in several cancers. However
Yunjia Yang et al.
Journal of cellular biochemistry, 120(10), 17744-17756 (2019-06-19)
Absent in melanoma 2 (AIM2) is a critical component in natural immunity system and is closely related to cancer initiation and development. It has been shown that AIM2 inhibited colorectal cancer (CRC) development and cell proliferation. It remains unresolved how
Ying Xu et al.
Oncotarget, 8(49), 86339-86355 (2017-11-22)
Hepatic ischemia/reperfusion (I/R) contributes to major complications in clinical practice affecting perioperative morbidity and mortality. Recent evidence suggests the key role of nucleotide-binding oligomerization domain-like receptor (NLR) family pyrin domain-containing 3 (NLRP3) inflammaosme activation on the pathogenesis of I/R injury.
Mehdi Farshchian et al.
Oncotarget, 8(28), 45825-45836 (2017-05-21)
Cutaneous squamous cell carcinoma (cSCC) is the most common metastatic skin cancer. Inflammation is a typical feature in cSCC progression. Analysis of the expression of inflammasome components in cSCC cell lines and normal human epidermal keratinocytes revealed upregulation of the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.