Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

Weitere Dokumente

EHU009611

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGGAGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATGTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGGATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTGATTTTAATGGCCACATCTAATCTCATTTCACATGAAAGAAGAAGTATATTTTAGAAATTTGTTAATGAGAGTAAAAGAAAATAAATGTGTATAGCTCAGTTTGGATAATTGGTCAAACAATTTTTTATCCAGTAGTAAAATATGTAACCATTGTCCCAGTAAAGAAAAATAACAAAAGTTGTAAAATGTATATTCTCCCTTTTATATTGCATCTGCTGTTACCCAG

Ensembl | Human Hinterlegungsnummer

ENSG00000138685

NCBI-Hinterlegungsnummer

NM_002006

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... FGF2(2247) , FGF2(2247)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaori Huang et al.
Oncology letters, 17(3), 3425-3431 (2019-03-15)
Increasing number of microRNAs (miRNAs) have been reported to play an important role in the development and progression of non-small cell lung cancer (NSCLC). In particular, microRNA-497-5p (miR-497-5p) has been proposed as a tumor suppressor miRNA in human cancers. However
Hongxue Wu et al.
Biochemical and biophysical research communications, 514(3), 933-939 (2019-05-16)
Cancer-associated fibroblasts comprise the major stromal cell populations in gastric cancer, which is a significant contributor to cancer-related death worldwide. As a member of the serine protease family, HTRA1 is reportedly involved in malignant transformation of various tumor types. In
Long He et al.
Journal of cancer research and therapeutics, 14(7), 1519-1524 (2018-12-28)
The objective of the study is to investigate the role of basic fibroblast growth factor (bFGF) in sensitivity to cisplatin in non-small cell lung cancer (NSCLC) A549 cells and its effect on the stemness characteristics of NSCLC cells, revealing possible
Yantao Han et al.
Cell biology international, 41(12), 1296-1306 (2017-08-10)
Vascular smooth muscle cell (VSMC) proliferation is a major contributor to atherosclerosis. This study investigated the inhibitory effects of oleanolic acid (OA) against oxidized low-density lipoprotein (ox-LDL)-induced VSMC proliferation in A7r5 cells and explored underlying molecular mechanism. The cell proliferation
Ana M Ruiz Lopez et al.
The European journal of neuroscience, 46(1), 1663-1672 (2017-05-12)
Retinitis pigmentosa (RP) is a group of hereditary retinal diseases, characterised by photoreceptor cell loss. Despite a substantial understanding of the mechanisms leading to cell death, an effective therapeutic strategy is sought. Our laboratory has previously demonstrated the neuroprotective properties
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.