Direkt zum Inhalt
Merck

EHU002941

Sigma-Aldrich

MISSION® esiRNA

targeting human SPARC

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACGGGTACCTCTCCCACACCGAGCTGGCTCCACTGCGTGCTCCCCTCATCCCCATGGAGCATTGCACCACCCGCTTTTTCGAGACCTGTGACCTGGACAATGACAAGTACATCGCCCTGGATGAGTGGGCCGGCTGCTTCGGCATCAAGCAGAAGGATATCGACAAGGATCTTGTGATCTAAATCCACTCCTTCCACAGTACCGGATTCTCTCTTTAACCCTCCCCTTCGTGTTTCCCCCAATGTTTAAAATGTTTGGATGGTTTGTTGTTCTGCCTGGAGACAAGGTGCTAACATAGATTTAAGTGAATACATTAACGGTGCTAAAAATGAAAATTCTAACCCAAGACATGACATTCTTAGCTGTAACTTAACTATTAAGGCCTTTTCCACACGCATTAATAGTCCCATTTTTCTCTTGCCATTTGTAGCTTTGCCCAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jing Zhu et al.
Stem cells (Dayton, Ohio), 38(1), 134-145 (2019-10-24)
The purpose of this study was to investigate the effects of secreted protein acidic and rich in cysteine (SPARC) on the maintenance of limbal epithelial stem cell (LESC) stemness and restoration of ocular surface. To determine the suitable concentration of
Jijun Fu et al.
Carcinogenesis, 38(6), 649-660 (2017-05-13)
Oncogene c-Myc is frequently amplified and activated in human cancers. Deregulation of c-Myc protein has been shown to occur in 30% of all human cancers, especially in hematopoietic malignancies. As a transcription factor, c-Myc has been shown to regulate up
Cho Rong Park et al.
Theranostics, 9(24), 7447-7457 (2019-11-07)
Human serum albumin (HSA) is the most abundant plasma protein. The main reason for using HSA as a versatile tool for drug delivery is based on its ability to accumulate in tumors. However, the mechanism of albumin accumulation in tumors
Katrina Viloria et al.
Scientific reports, 6, 37839-37839 (2016-11-26)
SPARC is a matricellular protein that is involved in both pancreatic cancer and diabetes. It belongs to a wider family of proteins that share structural and functional similarities. Relatively little is known about this extended family, but evidence of regulatory
Parul Choudhary et al.
PloS one, 10(6), e0130379-e0130379 (2015-06-30)
The integrity of the epithelium is maintained by a complex but regulated interplay of processes that allow conversion of a proliferative state into a stably differentiated state. In this study, using human embryonic stem cell (hESC) derived Retinal Pigment Epithelium

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.