Skip to Content
Merck
All Photos(1)

Key Documents

EMU208701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dlc1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAAAGAAAACAGAGTTTGGGCAAACCAGACCAGAAAGACCTGAATGAAAACCTAGCGGCGACTCAAGGGCTGGCCCACATGATTGCTGAGTGCAAGAAGCTCTTCCAGGTCCCTGAGGAAATGAGCCGGTGCCGTAACTCCTACACTGAACAAGAGCTGAAGCCCCTTACCCTGGAGGCCTTGGGACACCTGAATAGTGACCAGCCTGCTGACTACAGACACTTCCTCCAGGACTGTGTGGATGGCCTGTTTAAGGAGGTCAAAGAGAAGTTCAAAGGCTGGGTCAGCTACCCCACCTCCGAACAGGCTGAGCTGTCCTATAAGAAGGTCAGCGAAGGACCCCCGTTAAGGCTTTGGAGGTCAACTATCGAAGTCCCCGCTGCACCCGAGGAGATCTTAAAGCGCCTTCTGAAGGAGCAACACCTCTGGGATGTGGACCTGCTGGACTCCAAGGTGATTGAAATCCTGGACAGCCAGACTGAAATCTACCAATACGTCCAAAACAGCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mohammad Golam Sabbir et al.
PloS one, 7(7), e40302-e40302 (2012-07-14)
The Deleted in liver cancer one (Dlc1) tumor suppressor gene encodes a RhoGTPase activating protein (RhoGAP). The Dlc1 gene has multiple transcriptional isoforms and we have previously established a mouse strain containing a gene trap (gt) insertion, which specifically reduces
Ho-Suk Mun et al.
Scientific reports, 5, 17697-17697 (2015-12-08)
Understanding the mechanisms of memory formation is fundamental to establishing optimal educational practices and restoring cognitive function in brain disease. Here, we show for the first time in a non-primate species, that spatial learning receives a special bonus from self-directed
Yi-Ping Shih et al.
Biochimica et biophysica acta, 1853(12), 3258-3265 (2015-10-03)
DLC1 is a RhoGAP-containing tumor suppressor and many of DLC1's functions are absolutely dependent on its RhoGAP activity. Through its RhoGAP domain, DLC1 inhibits the activity of RhoA GTPase, which regulates actin cytoskeleton networks and dis/assembly of focal adhesions. Tensin1
Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service