Skip to Content
Merck
All Photos(1)

Key Documents

EMU177361

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Arid1a

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGATCAGATGGGAAAGATGAGACCTCAGCCGTATGGTGGGACTAACCCATACTCGCAACAACAGGGACCTCCTTCAGGACCGCAACAAGGACATGGGTACCCAGGGCAGCCATATGGGTCCCAGACTCCACAGCGGTACCCCATGACCATGCAGGGCCGGGCTCAGAGTGCCATGGGCAGCCTCTCTTATGCACAGCAGATTCCACCTTATGGCCAGCAAGGCCCCAGTGCGTATGGCCAGCAGGGCCAGACTCCATACTATAACCAGCAAAGTCCTCATCCCCAGCAGCAGCCACCTTACGCCCAGCAACCACCATCCCAGACCCCTCATGCCCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nan Wang et al.
Gynecologic oncology, 134(1), 129-137 (2014-05-06)
MicroRNAs(miRNAs) play important roles in tumor development and progression. The purposes of this study were to investigate the role of miR-31 in cervical cancer and clarified the regulation of ARID1A by miR-31. Quantitative RT-PCR was used to examine miR-31 expression
Xuxu Sun et al.
Cancer cell, 32(5), 574-589 (2017-11-15)
ARID1A, an SWI/SNF chromatin-remodeling gene, is commonly mutated in cancer and hypothesized to be tumor suppressive. In some hepatocellular carcinoma patients, ARID1A was highly expressed in primary tumors but not in metastatic lesions, suggesting that ARID1A can be lost after

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service