Skip to Content
Merck
All Photos(1)

Key Documents

EHU158101

Sigma-Aldrich

MISSION® esiRNA

targeting human JAG2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGGAGAAGTTCCTCTCACACAAATTCACCAAAGATCCTGGCCGCTCGCCGGGGAGGCCGGCCCACTGGGCCTCAGGCCCCAAAGTGGACAACCGCGCGGTCAGGAGCATCAATGAGGCCCGCTACGCCGGCAAGGAGTAGGGGCGGCTGCCAGCTGGGCCGGGACCCAGGGCCCTCGGTGGGAGCCATGCCGTCTGCCGGACCCGGAGGCCGAGGCCATGTGCATAGTTTCTTTATTTTGTGTAAAAAAACCACCAAAAACAAAAACCAAATGTTTATTTTCTACGTTTCTTTAACCTTGTATAAATTATTCAGTAACTGTCAGGCTGAAAACAATGGAGTATTCTCGGATAGTTGCTATTTTTGTAAAGTTTCCGTGCGTGGCACTCGCTGTATGAAAGGAGAGAGCAAAGGGTGTCTGCGTCGTCACCAAATCGTAGCGTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shouwen Chen et al.
Fish & shellfish immunology, 95, 277-286 (2019-11-02)
Interleukine-1β (IL-1β) is the first identified pro-inflammatory cytokine, which is cleaved by caspase-1 following the inflammasomes activation, playing critical roles in innate immunity. However, few studies have been performed to characterize the IL-1β in lower vertebrates. Herein, we distinguished the
Mo-fei Li et al.
Developmental and comparative immunology, 51(1), 141-147 (2015-03-25)
In mammals, CD83 is a surface marker on mature dendritic cells and vital to lymphocyte activation. In teleost, studies on the function of CD83 are very limited. In this study, we examined the potential involvement of turbot (Scophthalmus maximus) CD83
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service