Skip to Content
Merck
All Photos(2)

Key Documents

EHU106441

Sigma-Aldrich

MISSION® esiRNA

targeting human PTEN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Ke Wang et al.
Biochemical and biophysical research communications, 521(3), 652-659 (2019-11-05)
WW domain containing E3 Ub-protein ligase 2 (WWP2) plays an important role in tumor progression as an E3 ligase of PTEN. Here, we investigated the role of WWP2 in gastric cancer (GC). We found that WWP2 is overexpressed in GC
Bo Yuan et al.
OncoTargets and therapy, 13, 9147-9157 (2020-09-29)
Long non-coding RNA (lncRNA) cancer susceptibility candidate 9 (CASC9) has been reported to play a vital role in tumorigenesis. This study explored the biological role of CASC9 and its regulation mechanism in bladder cancer (BC). Gene expression was evaluated using
Zheng Jin et al.
OncoTargets and therapy, 13, 1073-1086 (2020-02-27)
Glioma is the most commonly diagnosed primary brain tumor. Dysregulation of long non-coding RNA (lncRNA) is associated with initiation and development of various cancer types including glioma. The relative expression of lncRNA was analyzed by real time-quantitative polymerase chain reaction
Guang-Tao Yu et al.
Oncotarget, 6(39), 42067-42080 (2015-11-18)
Myeloid-derived suppressor cells (MDSCs) and tumor associated macrophages (TAMs) play key roles in the tumor immune suppressive network and tumor progression. However, precise roles of programmed death-1 (PD-1) in immunological functions of MDSCs and TAMs in head and neck squamous

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Protocols

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service