Skip to Content
Merck
All Photos(1)

Key Documents

EHU097831

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGACCCAATACTCGGAGACTGACTGTTAGCACATGGCTCCTTCGTCAGGGCCTCATTGACACCAGCCTGACGGCATCTGTGGCCAACTTACTGGCTATTGCAATCGAGAGGCACATTACGGTTTTCCGCATGCAGCTCCACACACGGATGAGCAACCGGCGGGTAGTGGTGGTCATTGTGGTCATCTGGACTATGGCCATCGTTATGGGTGCTATACCCAGTGTGGGCTGGAACTGTATCTGTGATATTGAAAATTGTTCCAACATGGCACCCCTCTACAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Songbai Lin et al.
The American journal of pathology, 188(2), 353-366 (2017-11-13)
Intestinal epithelial cells form a barrier that is critical in protecting the host from the hostile luminal environment. Previously, we showed that lysophosphatidic acid (LPA) receptor 1 regulates proliferation of intestinal epithelial cells, such that the absence of LPA1 mitigates
Hui Ying Li et al.
Kidney international, 91(6), 1362-1373 (2017-01-24)
Lysophosphatidic acid (LPA) is known to regulate various biological responses by binding to LPA receptors. The serum level of LPA is elevated in diabetes, but the involvement of LPA in the development of diabetes and its complications remains unknown. Therefore
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.
Debashish Sahay et al.
Oncotarget, 6(24), 20604-20620 (2015-06-23)
Lysophosphatidic acid (LPA) is a bioactive lipid promoting cancer metastasis. LPA activates a series of six G protein-coupled receptors (LPA1-6). While blockage of LPA1in vivo inhibits breast carcinoma metastasis, down-stream genes mediating LPA-induced metastasis have not been yet identified. Herein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service