Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU195961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Srebf2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATTCTGACCACAATGCCTGTGATGATGGGGCAAGAGAAAGTTCCTATCAAGCAAGTGCCTGGCGGCGTGAAGCAGCTGGATCCTCCCAAAGAAGGAGAGAGGCGGACAACACACAATATCATTGAAAAGCGCTACCGGTCCTCCATCAACGACAAAATCATAGAGTTGAAGGACTTAGTCATGGGGACAGATGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATATCTGCAGCAGGTCAATCACAAGCTGCGCCAGGAGAACATGGTGCTGAAGCTGGCCAATCAGAAAAACAAGCTCCTGAAGGGCATCGACCTGGGCAGTCTGGTGGACAGTGATGTGGACTTGAAAATTGATGACTTTAACCAGAATGTCCTTCTGATGTCTCCGCCGGCCTCCGACTCCGGGTCCCAGGCCGGCTTCTCTCCCTATTCCATTGACTCTGAGCCGGGCAGCCCTCTGCTGGATGACGCAAAGGTCAAGGATGAACC

Numéro d'accès Ensembl | souris

ENSMUSG00000022463

Numéro d'accès NCBI

NM_033218

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... SREBF2(20788) , Srebf2(20788)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Young-Chae Kim et al.
Genome biology, 16, 268-268 (2015-12-05)
Fibroblast growth factor-19 (FGF19) is an intestinal hormone that mediates postprandial metabolic responses in the liver. The unusual orphan nuclear receptor, small heterodimer partner (SHP), acts as a co-repressor for many transcriptional factors and has been implicated in diverse biological
Ji Miao et al.
Nature communications, 6, 6498-6498 (2015-04-08)
Despite the well-documented association between insulin resistance and cardiovascular disease, the key targets of insulin relevant to the development of cardiovascular disease are not known. Here, using non-biased profiling methods, we identify the enzyme flavin-containing monooxygenase 3 (Fmo3) to be
Kazuki Inoue et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 29(8), 1823-1832 (2014-03-29)
Clarification of the mechanisms underlying osteoclast differentiation enables us to understand the physiology of bone metabolism as well as the pathophysiology of bone diseases such as osteoporosis. Recently, it has been reported that epigenetics can determine cell fate and regulate
Kenji Fukui et al.
The Journal of biological chemistry, 290(44), 26383-26392 (2015-09-16)
Diabetes mellitus is associated with a variety of complications, including alterations in the central nervous system (CNS). We have recently shown that diabetes results in a reduction of cholesterol synthesis in the brain due to decreased insulin stimulation of SREBP2-mediated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique