Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU194971

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mlkl

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGACAGATCATCAAGTTAGGCCAGCTCATCTATGAACAGTGTGAAAAGATGAAATACTGCCGGAAACAATGCCAGCGTCTAGGAAACCGTGTGCACGGCCTGCTACAGCCTCTCCAGAGACTCCAGGCCCAAGGAAAGAAGAACCTGCCCGATGACATTACTGCTGCCCTGGGCCGTTTTGATGAAGTCCTGAAGGAGGCTAACCAGCAGATAGAAAAGTTCAGCAAGAAGTCCCATATTTGGAAGTTTGTGAGTGTGGGCAATGATAAGATCCTCTTCCATGAAGTGAATGAGAAGCTGAGAGACGTCTGGGAGGAGCTGTTGCTGCTGCTTCAGGTTTATCATTGGAATACCGTTTCAGATGTCAGCCAGCCAGCATCCTGGCAGCAGGAAGATCGACAGGATGCAGAGGAAGACGGAAATGAAAATATGAAAGTTATCCTGATGCAGTTGCAAATTAGCGTGGAAGAAATCAACAAAACCC

Numéro d'accès Ensembl | souris

ENSMUSG00000012519

Numéro d'accès NCBI

NM_029005

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... MLKL(74568) , Mlkl(74568)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
Kipyegon Kitur et al.
PLoS pathogens, 11(4), e1004820-e1004820 (2015-04-17)
Staphylococcus aureus USA300 strains cause a highly inflammatory necrotizing pneumonia. The virulence of this strain has been attributed to its expression of multiple toxins that have diverse targets including ADAM10, NLRP3 and CD11b. We demonstrate that induction of necroptosis through

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique