Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU187301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ldha

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTCAAAAGATTCAAAGTCCAAGATGGCAACCCTCAAGGACCAGCTGATTGTGAATCTTCTTAAGGAAGAGCAGGCTCCCCAGAACAAGATTACAGTTGTTGGGGTTGGTGCTGTTGGCATGGCTTGTGCCATCAGTATCTTAATGAAGGACTTGGCGGATGAGCTTGCCCTTGTTGACGTCATGGAAGACAAACTCAAGGGCGAGATGATGGATCTCCAGCATGGCAGCCTCTTCCTTAAAACACCAAAAATTGTCTCCAGCAAAGACTACTGTGTAACTGCGAACTCCAAGCTGGTCATTATCACCGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guojun Hua et al.
Oncology reports, 31(6), 2727-2734 (2014-05-03)
Chondrosarcoma is a malignant cartilage-forming cancer composed of cells derived from transformed cells that produce cartilage. Conventional chemotherapy and radiotherapy have very limited efficacy in patients with advanced chondrosarcoma. In the present study, we reported a novel therapeutic approach in
Wenyi Sun et al.
PloS one, 10(5), e0125976-e0125976 (2015-05-15)
Oral squamous cell carcinoma (OSCC) comprises a subset of head and neck squamous cell carcinoma (HNSCC) with poor therapeutic outcomes and high glycolytic dependency. Neoadjuvant chemotherapy regimens of docetaxel, cisplatin and 5-fluorouracil (TPF) are currently accepted as standard regimens for
Balkrishna Chaube et al.
Oncotarget, 6(35), 37281-37299 (2015-10-21)
Melanoma is a largely incurable skin malignancy owing to the underlying molecular and metabolic heterogeneity confounded by the development of resistance. Cancer cells have metabolic flexibility in choosing either oxidative phosphorylation (OXPHOS) or glycolysis for ATP generation depending upon the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique