Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU170301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nol3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGAGGACCTGAGAGGAAACTTGAGTAGACAGAAGCCACACACATCATTGTAACTGCTGTTTAATTGTCTGGCTTTCCTCTGAACTGGGAGCTCAGTGAGGGGCGTGGGGTCTAACCAGTCACAGACATACACAAGGAGCTCTGCACATATCTACTAAGTAAATGAATACAAACTTCCCAGCTGTGTTTCCAAGCTTCACAGATGGAAACATTAACTGAAAAGCCAGGGTTAGGACAGTACTAGCTCACTCTCCCACCGCTGAATCTGAAGTGAAATGAAAGCCTTAACCAGCTCTGTACTAATCCTGGCCTGAACGTGGGATAACAAACCCTAGGGCCTGCCCTGTAGGTTTGATTGTGGTTGCTCCCGCCTGTCCTAACCACTGCCAGAGACCAGCTGTGAGGCTGTGGTTAAAGACAGGCACAACCAAGACTAACATGGGGACTGAGGGTGGGACCAGGTGCTGGACTCACAAGACACAAGACACAGTGTGTCTGTGTGAGTGATAAGAAAGGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and
Andrea Ullius et al.
Nucleic acids research, 42(11), 6901-6920 (2014-05-02)
The appropriate expression of the roughly 30,000 human genes requires multiple layers of control. The oncoprotein MYC, a transcriptional regulator, contributes to many of the identified control mechanisms, including the regulation of chromatin, RNA polymerases, and RNA processing. Moreover, MYC

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique