Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU088711

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atp11c

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGAAAATGCAAAGCGAGTGAGGAAAGAAAGTGAAAAAATCAAGGTTGGTGATGTAGTAGAAGTACAGGCAAATGAAACCTTTCCCTGTGATCTTATACTTCTGTCATCCTGCACAACTGATGGAACCTGTTATGTCACTACAGCCAGTCTTGATGGTGAATCTAATTGCAAGACACATTATGCAGTACGAGATACCATTGCACTGTGTACAGCCGAATCCATTGATAATCTCCGAGCAACAATTGAATGTGAGCAGCCTCAACCTGATCTCTACAGGTTTGTTGGGCGAATCAGTATCTATAGTAATAGTATTGAGGCTGTTGCCAGGTCTTTGGGACCTGAAAATCTTTTGCTGAAAGGAGCCACACTTAAAAATACCAAGAAGATATATGGAGTTGCTGTTTACACTGGGATGGAAACCAAAATGGCTTTGAACTACCAAGGGAAATCTCAGAAATGTTCTGCTGTTGAAAAATCTATTAATGCCTTCTTGATTGTTTATTTATTTATCTTACTGACCAAAGCTGCAGTATGCA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Paweł Jóźwiak et al.
Nutrition and cancer, 67(8), 1333-1341 (2015-09-19)
Enhanced glucose requirement of cancer cells is associated with an increased glucose transport across plasma membrane that is mediated by a family of facilitated glucose transporter proteins, named GLUTs. GLUT1 is the main transporter in thyroid cancer cells. Glucose is
Michael Moldavan et al.
The European journal of neuroscience, 42(12), 3018-3032 (2015-09-24)
GABA is a principal neurotransmitter in the suprachiasmatic hypothalamic nucleus (SCN), the master circadian clock. Despite the importance of GABA and GABA uptake for functioning of the circadian pacemaker, the localization and expression of GABA transporters (GATs) in the SCN
Taryn E Travis et al.
Journal of burn care & research : official publication of the American Burn Association, 36(3), e125-e135 (2014-07-23)
The duroc pig has been described as a promising animal model for use in the study of human wound healing and scar formation. However, little is known about the presence and chronology of the fibrocyte cell population in the healing
Chong-Shan Shi et al.
Journal of immunology (Baltimore, Md. : 1950), 193(6), 3080-3089 (2014-08-20)
Coronaviruses (CoV) have recently emerged as potentially serious pathogens that can cause significant human morbidity and death. The severe acute respiratory syndrome (SARS)-CoV was identified as the etiologic agent of the 2002-2003 international SARS outbreak. Yet, how SARS evades innate
Edith Suzarte et al.
International immunology, 27(8), 367-379 (2015-03-22)
Our group developed a subunit vaccine candidate against dengue virus based on two different viral regions: the domain III of the envelope protein and the capsid protein. The novel chimeric protein from dengue-2 virus [domain III-capsid (DIIIC-2)], when presented as

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique