Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU078861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ep300

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGTGTCCTTCACCACGAGATCATCTGGCCATCTGGGTTTGTCTGTGATGGCTGTTTAAAGAAAACTGCACGAACTAGGAAAGAAAATAAGCTTTCTGCTAAAAGATTGCCATCTACCAGACTTGGGACCTTTCTGGAGAATCGAGTGAATGACTTTCTGAGGCGACAAAATCACCCTGAATCAGGAGAGGTCACTGTTCGGGTTGTTCATGCTTCTGACAAAACTGTGGAAGTGAAACCAGGCATGAAAGCAAGGTTTGTAGATAGTGGAGAGATGGCAGAATCTTTTCCATACCGAACAAAGGCCCTGTTTGCCTTTGAAGAAATTGATGGTGTTGACTTGTGTTTCTTCGGCATGCATGTTCAAGAATATGGCTCTGACTGCCCCCCTCCCAACCAGAGGAGGGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGC

Numéro d'accès Ensembl | souris

ENSMUSG00000055024

Numéro d'accès NCBI

NM_177821

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... EP300(328572) , Ep300(328572)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guanqiao Wang et al.
Cellular signalling, 27(7), 1369-1379 (2015-04-07)
Carbonic anhydrase IX(CA9)is a member of the carbonic anhydrase family that catalyzes the reversible hydration of carbon dioxide, and plays a key role in the regulation of pH. Although a large number of studies have shown that CA9 is strongly
Erli Zhang et al.
PloS one, 10(12), e0143814-e0143814 (2015-12-03)
Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as "metabolic memory." Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and
Jihong Chen et al.
Scientific reports, 5, 13727-13727 (2015-09-12)
Skeletal myogenesis is a highly ordered process which specifically depends on the function of transcriptional coactivator p300. Previous studies have established that Akt/protein kinase B (PKB), a positive regulator of p300 in proliferating cells, is also important for proper skeletal
Smita S Ghare et al.
Journal of immunology (Baltimore, Md. : 1950), 193(1), 412-421 (2014-06-06)
Activation-induced Fas ligand (FasL) mRNA expression in CD4+ T cells is mainly controlled at transcriptional initiation. To elucidate the epigenetic mechanisms regulating physiologic and pathologic FasL transcription, TCR stimulation-responsive promoter histone modifications in normal and alcohol-exposed primary human CD4+ T

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique