Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU052671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Msi1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTTCGGCTTCGTCACTTTCATGGACCAGGCGGGGGTGGATAAAGTGCTGGCGCAATCGCGGCACGAGCTCGACTCCAAAACAATTGACCCCAAGGTGGCCTTTCCTCGAAGAGCACAGCCTAAGATGGTCACTCGGACGAAGAAGATCTTCGTGGGGGGGCTGTCTGTGAACACCACGGTGGAAGATGTGAAACACTATTTCGAGCAGTTCGGAAAGGTGGATGATGCCATGCTGATGTTCGACAAAACCACCAACAGGCACAGAGGGTTTGGATTTGTCACGTTTGAGAGCGAGGACATCGTAGAGAAAGTTTGTGAGATCCACTTCCATGAAATCAACAACAAAATGGTGGAATGCAAGAAAGCCCAGCCAAAGGAGGTGATGTCCCCGACAGGCTCAGCCCGGGGCAGGTCTCGGGTCATGCCCTACGGAATGGATGCCTTCATGCTGGGTAT

Numéro d'accès Ensembl | souris

ENSMUSG00000054256

Numéro d'accès NCBI

NM_008629

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... MSI1(17690) , Msi1(17690)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mitzli X Velasco et al.
RNA (New York, N.Y.), 25(7), 768-782 (2019-04-21)
RNA-binding proteins (RBPs) and miRNAs are critical gene expression regulators that interact with one another in cooperative and antagonistic fashions. We identified Musashi1 (Msi1) and miR-137 as regulators of a molecular switch between self-renewal and differentiation. Msi1 and miR-137 have
In-Sun Hong et al.
PloS one, 8(2), e56496-e56496 (2013-02-19)
Human umbilical cord blood (UCB)-derived mesenchymal stem cells (MSCs) are essential tools for regenerative medicine due to their capacity for self-renewal and multi-lineage differentiation. As MSCs are found in very small numbers in various tissues, in vitro cell expansion is
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique