Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU052501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGTGGATCGCCAAATTATGCAGCACCTGAGGTCATCTCAGGAAGGCTGTATGCAGGTCCCGAGGTCGATATCTGGAGCTGTGGTGTCATCCTGTATGCCCTTCTCTGTGGCACCCTCCCTTTCGATGATGAGCACGTGCCTACGCTCTTCAAGAAGATCCGAGGGGGTGTGTTTTACATCCCAGACTATCTCAACCGTTCTGTCGCCACTCTGCTGATGCACATGCTCCAGGTGGACCCCCTGAAGCGAGCGACTATCAAAGACATACGAGAACATGAATGGTTTAAACAGGATTTGCCCAGCTACCTATTTCCTGAAGACCCCTCCTACGATGCGAATGTCATTGTCGATGAGGCTGTGAAGGAAGTCTGTGAGAAATTCGAGTGTACAGAGTCAGAAGTGATGAATAGTCTGTATAGTGGTGACCCTCAAGACCAGCTTGCAGTGGCTTAT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sreevidya Santha et al.
The Journal of biological chemistry, 290(36), 21865-21875 (2015-07-23)
Prostate cancer (PCa) is one of the most frequently diagnosed cancers in men with limited treatment options for the hormone-resistant forms. Development of novel therapeutic options is critically needed to target advanced forms. Here we demonstrate that combinatorial treatment with
Sravanth K Hindupur et al.
Breast cancer research : BCR, 16(4), 420-420 (2014-08-07)
Matrix detachment triggers anoikis, a form of apoptosis, in most normal epithelial cells, while acquisition of anoikis resistance is a prime requisite for solid tumor growth. Of note, recent studies have revealed that a small population of normal human mammary
Xia Cao et al.
Hypertension research : official journal of the Japanese Society of Hypertension, 37(9), 803-810 (2014-06-27)
The purpose of this study was to determine the effects of resveratrol (RSV) and the molecular mechanisms by which it regulates vascular smooth muscle contraction and blood pressure in mice. In cultured human vascular smooth muscle cells (VSMCs), we found
Teraneh Z Jhaveri et al.
Oncotarget, 6(17), 14754-14765 (2015-07-06)
AMP-activated Protein Kinase (AMPK) activity retards growth of many types of cancers. Investigating effects of AMPK activation on breast cancer cell signaling and survival, we found that breast cancer cell lines with amplification and over-expression of HER2 or EGFR are
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique