Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU046421

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Traf6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTCCCTGACGGTAAAGTGCCCAAATAAAGGCTGTTTGCAAAAGATGGAACTGAGACATCTCGAGGATCATCAAGTACATTGTGAATTTGCTCTAGTGAATTGTCCCCAGTGCCAACGTCCTTTCCAGAAGTGCCAGGTTAATACACACATTATTGAGGATTGTCCCAGGAGGCAGGTTTCTTGTGTAAACTGTGCTGTGTCCATGGCATATGAAGAGAAAGAGATCCATGATCAAAGCTGTCCTCTGGCAAATATCATCTGTGAATACTGTGGTACAATCCTCATCAGAGAACAGATGCCTAATCATTATGATCTGGACTGCCCAACAGCTCCAATCCCTTGCACATTCAGTGTTTTTGGCTGTCATGAAAAGATGCAGAGGAATCACTTGGCACGACACTTG

Numéro d'accès Ensembl | souris

ENSMUSG00000027164

Numéro d'accès NCBI

NM_009424

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... TRAF6(22034) , Traf6(22034)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Melinda E Varney et al.
The Journal of experimental medicine, 212(11), 1967-1985 (2015-10-16)
TRAF-interacting protein with forkhead-associated domain B (TIFAB) is a haploinsufficient gene in del(5q) myelodysplastic syndrome (MDS). Deletion of Tifab results in progressive bone marrow (BM) and blood defects, including skewed hematopoietic stem/progenitor cell (HSPC) proportions and altered myeloid differentiation. A
Frank Secreto et al.
Leukemia & lymphoma, 55(8), 1884-1892 (2013-11-12)
B-cell activating factor-receptor (BAFF-R) is the primary BAFF receptor that is responsible for promoting B-cell development and survival. Malignant B-cells exploit the BAFF/BAFF-R system, and high serum BAFF levels or genetic alterations in BAFF receptors have been found in B-cell
Domenico Somma et al.
Journal of immunology (Baltimore, Md. : 1950), 194(7), 3286-3294 (2015-02-25)
IL-17 is a proinflammatory cytokine that promotes the expression of different cytokines and chemokines via the induction of gene transcription and the posttranscriptional stabilization of mRNAs. In this study, we show that IL-17 increases the half-life of the Zc3h12a mRNA

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique