Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU045231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Foxo3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGGAGTTTGGTCAATCAGAACTTGCTCCACCACCAGCACCAAACCCAGGGCGCTCTTGGTGGCAGCCGTGCCTTGTCAAATTCTGTCAGCAACATGGGCTTGAGTGACTCCAGCAGCCTTGGCTCAGCCAAACACCAGCAGCAGTCTCCCGCCAGCCAGTCTATGCAAACCCTCTCGGACTCTCTCTCAGGCTCCTCACTGTATTCAGCTAGTGCAAACCTTCCCGTCATGGGCCACGATAAGTTCCCCAGTGACTTGGACCTGGACATGTTCAATGGGAGCTTGGAATGTGACATGGAGTCCATCATCCGTAGTGAACTCATGGATGCTGACGGGTTGGATTTTAACTTTGACTCCCTCATCTCCACACAGAACGTTGTTGGTTTGAATGTGGGGAACTTCACTGGTGCTAAGCAGGCCTCATCTCAAAGCTGGGTACCAGGCTGAAGGATCACTGAGGAAAGGGGAAATGGGCAAAGCAGACCCTCAAACTGACGGRAGACCTACAGAGRAAACCCTTTGCCAAATYTGCTYTCAGCAAGTGGACAGTGATCCGTTTACAGCTTGACACCTTTGAGACTCCCACG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jangsoon Lee et al.
Breast cancer research and treatment, 146(2), 259-272 (2014-06-12)
Although there are effective HER2-targeted agents, novel combination strategies in HER2-overexpressing breast cancers are needed for patients whose tumors develop drug resistance. To develop new therapeutic strategy, we investigated the combinational effect of entinostat, an oral isoform-selective histone deacetylase type
Xuan Zhao et al.
Oncotarget, 6(8), 5582-5596 (2015-02-26)
Anti-apoptotic protein Mcl-1 plays an important role in protecting cell from death in acute myeloid leukemia (AML). The apoptosis blocking activity of Mcl-1 is inhibited by BH3-only protein Noxa. We found that dihydroartemisinin (DHA) and its derivative X-11 are potent

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique